Transcriptome profiling revealed changes of multiple genes involved in defense response in Polyporus umbellatus with Armillaria mellea infection




Дата канвертавання25.04.2016
Памер54.19 Kb.
Transcriptome profiling revealed changes of multiple genes involved in defense response in Polyporus umbellatus with Armillaria mellea infection

Meng-Meng Liu, Yong-Mei Xing, Da-Wei Zhang, Shun-Xing Guo


Institute of Medicinal Plant Development, Chinese Academy of Medical Sciences & Peking Union Medical College, Beijing 100193, P. R. China


GO_accession

Description

Term_type

pValue

GO:0004298

threonine-type endopeptidase activity

molecular_function

4.81E-05

GO:0070003

threonine-type peptidase activity

molecular_function

4.81E-05

GO:0000502

proteasome complex

cellular_component

0.00010897

GO:0006457

protein folding

biological_process

0.00035698

GO:0044425

membrane part

cellular_component

0.00054522

GO:0043565

sequence-specific DNA binding

molecular_function

0.0010503

GO:0019643

reductive tricarboxylic acid cycle

biological_process

0.0013155

GO:0006333

chromatin assembly or disassembly

biological_process

0.0016692

GO:0008483

transaminase activity

molecular_function

0.0019432
Supplementary Table S1. GO enrichment of up-regulated DEGs in the CT sample
Supplementary Table S2. GO enrichment of down-regulated DEGs in CT sample

GO_accession

Description

Term_type

pValue

GO:0005198

structural molecule activity

molecular_function

0.000488

GO:0005200

structural constituent of cytoskeleton

molecular_function

0.0042

GO:0004417

hydroxyethylthiazole kinase activity

molecular_function

0.005237

GO:0003735

structural constituent of ribosome

molecular_function

0.007076

GO:0010033

response to organic substance

biological_process

0.00743

GO:0044085

cellular component biogenesis

biological_process

0.008138

GO:0008171

O-methyltransferase activity

molecular_function

0.013023

GO:0019028

viral capsid

cellular_component

0.014283

GO:0009123

nucleoside monophosphate metabolic process

biological_process

0.014901

Supplementary Table S3. KEGG pathway enrichment of up-regulated DEGs in the CT

#Term

Sample number

P-Value

Proteasome

62

1.79E-09

Adherens junction

23

0.002071

Biosynthesis of unsaturated fatty acids

31

0.002959

Arginine and proline metabolism

51

0.003146

beta-Alanine metabolism

35

0.003726

Citrate cycle (TCA cycle)

43

0.004838

MAPK signaling pathway - fly

7

0.007085

TGF-beta signaling pathway

23

0.012976

Ras signaling pathway

35

0.017903

Pyruvate metabolism

56

0.02005


Supplementary Table S4. KEGG pathway enrichment of down-regulated DEGs in the CT

#Term

Sample number

P-Value

Ribosome

49

4.00E-05

Alanine, aspartate and glutamate metabolism

12

0.018151

Pantothenate and CoA biosynthesis

7

0.021351

Glycosylphosphatidylinositol(GPI)-anchor biosynthesis

6

0.037193

Nitrogen metabolism

6

0.048743

Two-component system

7

0.052301

Peroxisome

15

0.054402

Phosphatidylinositol signaling system

8

0.06497

Inositol phosphate metabolism

8

0.091361

Nicotinate and nicotinamide metabolism

5

0.104908



Supplementary Table S5. Primers for qRT-PCR analysis

Accession No.

Annotation

Primer set

Forward primer (5’-3’)

Reverse primer (5’-3’)

comp15020_c0

GPDH

caaaatactggcaaagtggaaa

acctttcatacaccccttcct

comp20579_c0

bgl

ATGACAACTGGAGAGGAGAGTA

CGGCATCTAATTGACGAATGTT

comp22715_c0

CAX

CACCTCTCAGCACTCACTCA

CATCCAACCTACCACAACACAA

comp26188_c0

NADH

CCGAGTCTTCTGGCGTGAT

TCCGAGGCGTAGAGTTCCA

comp29904_c0

lectin

GGTATTCGCACCATTGACAGA

GGAAGACTCATACACGCTCTAC

comp30922_c0

GalU

CTCCTTCGTCCTCGTCACAA

ACATCGTCCGCTGCCTATC

comp33865_c0

Hsp

TCGCTCGCTCACTGAATGG

AAGGTACGCTCGCTCTTGTT

Comp34861_c0

PDR

CCGCACTGTCATTCTCGTATC

CCGTCGTAGTCTCCTGAGTATT

comp31131_c0

GTs

ATAGTCTGGCGAGAGTTGTTGA

AAGGATGCGGTGGAAGGTTAT

Comp26507_c2

bg1

CAGGTGTTCCGCAATGTCAAGG

GCGAAGACACGAGGTAGGTTCC

Comp30459_c0

EG

GCAGCATCACCAACCTCGTCTT

TCCACCGCCAGTCTCAGTGTT

Comp33782_c0

TLP

TTCTTCGGCGTTCACCTGAGAC

TGCTGTTACCTGGAGTCCCTCT

Comp16336_c0

WD40

GAAGCATGGACCACACAATG

AAAGTTGCACGGCATTAACC

Previously identified

β-tublin

CCTTCCTTGGCAACTCGACA

TCGTCCATACCCTCCTGTGT


База данных защищена авторским правом ©shkola.of.by 2016
звярнуцца да адміністрацыі

    Галоўная старонка