Supplementary Materials Characterization of the Scutellaria barbata glycosyltransferase gene and its promoter




Дата канвертавання26.04.2016
Памер85.02 Kb.
Supplementary Materials

Characterization of the Scutellaria barbata glycosyltransferase gene and its promoter

Planta


Shu-Jiau Chiou · Wen-Yi Liu · Cheng-Li Fang · Tsai-Yun Lin

Tsai-Yun Lin ()

Department of Life Science and Institute of Bioinformatics and Structural Biology, National Tsing Hua University, No. 101, Sec. 2, Kuang Fu Rd., Hsinchu, 30013 Taiwan, R.O.C.

E-mail: tylin@life.nthu.edu.tw



Phone: +886-3-574-2578

Fax: +886-3-571-5934



Supplementary Table 1 PCR primers used in this study


(A) Primers designed for genome walking

Sequence1

Position2

Construct

(pCR2.1 or pBI121)



SbP-GSP1

5'- TCATTGGAACAAGGATAATATGTAGCT -3'

+119 to +145

pCR-SbP

SbP-850U


SbP-GSP2

5'- TGTAAAATGGAAAGATCTTAATTATG -3'

+78 to +103

(B) Primers designed for serial deletions










SbP-F1

5'- GTGTCCAATTCCTGCAGGCTCTAATCTAG -3'

127 to 98

pCR-109

SbP-109


SbP-F3

5'- TAAGAGTATCCTGCAGGAATGTAGGAAT -3'

216 to 198

pCR-215

SbP-215


SbP-F4

5'- CATAAACTAACCTGCAGGCAATCCAAC - 3'

262 to 235

pCR-250

SbP-250


SbP-F5

5'- TACATTAATCCTGCAGGACACACCCTATTTT -3'

403 to 381

pCR-392

SbP-392


SbP-BamR

5'- TGGCCTGCATGAGAAAGGATCCAATATAGGAT -3'

+33 to +4




SbP-D5-F

SbP-D5-R


5'- CCAACTTTTTTTTCAATTTGACTC -3'

5'- GAGTCAAATTGAAAAAAAAGTTGG -3'



240 to 228

177 to 167



pCR-39262

SbP-39262



(C) Primers designed for intron detection










SbUGT-full-F

SbUGT-in-R

SbUGT-in-F

SbUGT-full-R



5'-TGAAATGGGACAGCTACATATTATC-3'

5'-TTCCTTCCAAAGTCGAGTTCCATCCACA-3'

5'-TCAACTCAAAAAAGCCCAACTCAGTTGT-3'

5'-CTAGTTTATGGCCAGTTTCATA-3'



+107 to +132

+1186 to +1213

+920 to +947

+1524 to +1545






(D) Primers designed for RT-PCR and real time RT-PCR










SbGT-RT-F

SbGT-RT-R

SbGT-qRT-F

SbGT-qRT-R

Actin-F

Actin-R


5'-ATTGCCAGACAACATATTGAG-3'

5'-GTGGAAGATTCGGAATGAC-3'

5'-TTCTTGCCATGGACGACTG-3'

5'-ATGGAAGATCAACCTCGGAAT-3'

5'-TCACCATTGGAGCTGAGAGATTC-3'

5'-CTGCAGCTTCCATTCCAATCA-3'



+207 to +227

+493 to +511

+458 to +475

+496 to +516






1Nucleotides changed to create a restriction endonuclease cleavage site are underlined

2Position is given relative to the putative SbUGT transcription start site

Supplementary Table 2 Cis-acting regulatory elements in SbUGT promoter.

The SbUGT promoter sequence was screened against PlantCARE and PLACE databases. The positions are given relative to the putative transcription start site of the SbUGT promoter




Name

Position

Sequence

Putative function

Reference

Pyrimidine box

-148 (+)

-53 (+)


-440 (+)

-727 (-)


TTTCTTCTCT
TTTTTTCC

Cis-acting element conferring high transcription levels

GA and ABA-responsive element



Daraselia et al. (1996)

Cercós et al. (1999)



ABRE

-122 (-)

-956 (+)


GGACACGTGGC

CACGTG


Cis-acting element involved in the abscisic acid responsiveness

Hobo et al. (1999)

MYB motif

-771 (+)

-548 (+)


-546 (-)

CNGTTR

Regulate genes responsive for plant development, flavonoid biosynthesis and ABA

Romero et al. (1998)

Wu et al.. (2006)



CE3

-132 (+)

GACGCGTGTC

Cis-acting element involved in ABA and VP1 responsiveness

Hobo et al. (1999)

AT1-motif

-613 (-)

ATTAATTTTACA

Light responsive module

Datta and Cashmore (1989)

Box-W1

-918 (-)

TTGACC

Fungal elicitor responsive element

Rushton et al. (1998)

G-Box

-131 (+)

-956 (±)


-946 (+)

ACACGTGT

CACGTG


CACGAC

Cis-acting regulatory element involved in light responsiveness

Safrany et al. (2008)

I box

-91 (+)

-188 (+)


-318 (+)

-720 (-)


GATAA

Light-responsive

Fiebig and Link (1992)

CAAT-box

+63 (-)

+60 (+)


-62 (+)

-171 (-)


-286 (+)

-365 (+)


-416 (+)

-433 (+)


-579 (-)

-720 (+)


CAAAT

Cis-acting element in promoter and enhancer regions

Rieping and Schöffl (1992)

CGTCA-motif

-368 (+)

-68 (+)


CGTCA

Cis-acting regulatory element involved in the MeJA-responsiveness

Rouster et al. (1997)

ELI-box3

-154 (-)

AAACCAATT

Elicitor-responsive element




GARE motif

-35 (-)

AAACAGA

Gibberellin-responsive element

Ogawa et al. (2003)

GCN4 motif

-176 (-)

TGAGTCA

Cis-regulatory element involved in endosperm expression

Washida et al. (1999)

MBS motif

-766 (-)

CAACTG

MYB binding site involved in drought

Simpson et al. (2003)

TCA element

-240 (+)

CCATCTTTTT

Cis-acting element involved in salicylic acid responsiveness

Rushton et al. (1998)

W box

-172 (+)

-182 (+)


-701 (+)

-814 (-)


TGACT

Sugar and/or wound-inducible element

Sun et al. (2003)

WB box

-174 (+)

-818 (-)


TTTGACY

Responsive to abiotic and biotic stresses, biosynthetic pathway and hormone signaling

Eulgem et al. (2000)

Amylase box

-476 (+)

TATCCAT

Sugar response element

Lu et al.. (1998)

A box

-82 (+)

TACGTA

Sugar-repression element

Toyofuku et al. (1998)

TATCCAT/C motif

-750 (+)

GAGAAGAATA

Sugar-responsive

Lu et al.. (1998)

GT1 box

-312 (+)

-434 (-)


-605 (-)

-733 (+)


GAAAAA

NaCl and pathogen-inducible element

Park et al. (2004)

AGAAA motif


+18 (-)

-144 (-)


-313 (+)

-462 (+)


-619 (-)

-660 (+)


-670 (-)

-851 (-)


-858 (-)

-902 (-)


AGAAA

Pollen-specific

Bate and Twell (1998)

Root motif

-26 (+)

-293 (±)


-362 ±)

-377 (-)


-427(-)

-585 (+)


+7 (+)

+40 (±)


+74 (-)

ATATT

Root-specific

Elmayan and Tepfer (1995)

OSE2

-169 (+)

-221 (-)


-461 (-)

-516 (-)


CTCTT

Root-specific expression

Stougaard et al. (1990)

RY repeat motif

+23 (+)

CATGCA

Seed-specific

Bäumlein et al. (1992)

NRR motif

-1072 (-)

TAGTGGAT

Stress negative regulatory element

Elliott and Shirsat (1998)

E box

-130 (+)

-155 (+)


-763 (+)

-771 (+)


-956 (+)

CANNTG

MYC-recognition site

Tissue-specific

Light-responsive


Hartmann et al. (2005)

KCACGW

-124 (-)

-947 (±)


-1023 (+)




Root hair-specific cis-elements

Shangguan et al. (2008)


References

Bate N, Twell D (1998) Functional architecture of a late pollen promoter: pollen-specific transcription is developmentally regulated by multiple stage-specific and codependent activator elements. Plant Mol Biol 37:859–869

Bäumlein H, Nagy I, Villarroel R, Inzé D, Wobus U (1992) Cis-analysis of a seed protein gene promoter: the conservative RY repeat CATGCATG within the legumin box is essential for tissue-specific expression of a legumin gene. Plant J 2:233-239

Cercós M, Gómez-Cadenas A, Ho TH (1999) Hormonal regulation of a cysteine proteinase gene, EPB-1, in barley aleurone layers: cis- and trans-acting elements involved in the co-ordinated gene expression regulated by gibberellins and abscisic acid. Plant J 19:107-118

Daraselia ND, Tarchevskaya S, Narita JO (1996) The promoter for tomato 3-hydroxy-3-methylglutaryl coenzyme A reductase gene 2 has unusual regulatory elements that direct high-level expression. Plant Physiol 112:727-733

Datta N, Cashmore AR (1989) Binding of a pea nuclear protein to promoters of certain photoregulated genes is modulated by phosphorylation. Plant Cell 1:1069-1077

Elliott KA, Shirsat AH (1998) Promoter regions of the extA extensin gene from Brassica napus control activation in response to wounding and tensile stress. Plant Mol Biol 37:675-687

Elmayan T, Tepfer M (1995) Evaluation in tobacco of the organ specificity and strength of the rol D promoter, domain A of the 35S promoter and the 35S2 promoter. Transgenic Res 4:388–396

Eulgem T, Rushton PJ, Robatzek S, Somssich IE (2000) The WRKY superfamily of plant transcription factors. Trends Plant Sci 5:199-206

Fiebig C, Link G (1992) 5'-upstream cis-elements and binding factor(s) potentially involved in light-regulated expression of a Brassica napus rbcS gene. Curr Genet 21:161-168

Hartmann U, Sagasser M, Mehrtens F, Stracke R, Weisshaar B (2005) Differential combinatorial interactions of cis-acting elements recognized by R2R3-MYB, BZIP, and BHLH factors control light-responsive and tissue-specific activation of phenylpropanoid biosynthesis genes. Plant Mol Biol 57:155-171

Hobo T, Asada M, Kowyama Y, Hattori T (1999) ACGT-containing abscisic acid response element (ABRE) and coupling element 3 (CE3) are functionally equivalent. Plant J 19:679-689

Lu CA, Lim EK, Yu SM (1998) Sugar response sequence in the promoter of a rice -amylase gene serves as a transcriptional enhancer. J Biol Chem 273:10120-10131

Ogawa M, Hanada A, Yamauchi Y, Kuwahara A, Kamiya Y, Yamaguchi S (2003) Gibberellin biosynthesis and response during Arabidopsis seed germination. Plant Cell 15:1591-1604

Park HC, Kim ML, Kang YH, Jeon JM, Yoo JH, Kim MC, Park CY, Jeong JC, Moon BC, Lee JH, Yoon HW, Lee SH, Chung WS, Lim CO, Lee SY, Hong JC, Cho MJ (2004) Pathogen- and NaCl-induced expression of the SCaM-4 promoter is mediated in part by a GT-1 box that interacts with a GT-1-like transcription factor. Plant Physiol 135:2150-2161

Rieping M, Schöffl F (1992) Synergistic effect of upstream sequences, CCAAT box elements, and HSE sequences for enhanced expression of chimeric heat shock genes in transgenic tobacco. Mol Gen Genet 231:226-232

Romero I, Fuertes A, Benito MJ, Malpica JM, Leyva A, Paz-Ares J (1998) More than 80 R2R3-MYB regulatory genes in the genome of Arabidopsis thaliana. Plant J 14:273-284

Rouster J, Leah R, Mundy J, Cameron-Mills V (1997) Identification of a methyl jasmonate-responsive region in the promoter of a lipoxygenase 1 gene expressed in barley grain. Plant J 11:513-523

Rushton PJ, Somssich IE (1998) Transcriptional control of plant genes responsive to pathogens. Curr Opin Plant Biol 1:311–315

Safrany J, Haasz V, Mate Z, Ciolfi A, Feher B, Oravecz A, Stec A, Dallmann G, Morelli G, Ulm R, Nagy F (2008) Identification of a novel cis-regulatory element for UV-B-induced transcription in Arabidopsis. Plant J 54:402-414

Shangguan XX, Xu B, Yu ZX, Wang LJ, Chen XY (2008) Promoter of a cotton fiber MYB gene functional in trichomes of Arabidopsis and glandular trichomes of tobacco. J Exp Bot 59:3533-3542

Simpson SD, Nakashima K, Narusaka Y, Seki M, Shinozaki K, Yamaguchi-Shinozaki K (2003) Two different novel cis-acting elements of erd1, a clpA homologous Arabidopsis gene function in induction by dehydration stress and dark-induced senescence. Plant J 33:259-270

Stougaard J, Jørgensen JE, Christensen T, Kühle A, Marcker KA (1990) Interdependence and nodule specificity of cis-acting regulatory elements in the soybean leghemoglobin lbc3 and N23 gene promoters. Mol Gen Genet 220:353-360

Sun C, Palmqvist S, Olsson H, Borén M, Ahlandsberg S, Jansson C (2003) A novel WRKY transcription factor, SUSIBA2, participates in sugar signaling in barley by binding to the sugar-responsive elements of the iso1 promoter. Plant Cell 15:2076-2092

Toyofuku K, Umemura T, Yamaguchi J (1998) Promoter elements required for sugar-repression of the RAmy3D gene for alpha-amylase in rice. FEBS Lett 428:275-280

Washida H, Wu CY, Suzuki A, Yamanouchi U, Akihama T, Harada K, Takaiwa F (1999) Identification of cis-regulatory elements required for endosperm expression of the rice storage protein glutelin gene GluB-1. Plant Mol Bio 40:1-12



Wu AM, Ling C, Liu JY (2006) Isolation of a cotton reversibly glycosylated polypeptide (GhRGP1) promoter and its expression activity in transgenic tobacco. J Plant Physiol 163:426-435


База данных защищена авторским правом ©shkola.of.by 2016
звярнуцца да адміністрацыі

    Галоўная старонка