Supplemental Table pcr primers used in this study




Дата канвертавання25.04.2016
Памер74.57 Kb.
Supplemental Table S1. PCR primers used in this study.


Primer name

Sequence



5’UTR-F

GCGGGGGCAAAATAGTAGA

3’UTR-R

CGATTATTGATCGGTGAATGC

ΔTP-Cl-PT1a-F

GTACTAGTATGGGCTTGAACAGAAGTGAAAGCAAGA

ΔTP-Cl-PT1a-R

TCTCGAGTCATCGTAAGAAGTGAATAAGGAGATA

Cl-PT1a-TP-F

GTGGATCCATGCTTCAAATGCATTCGAATTC

Cl-PT1a-TP-R

CACTCGAGGCAACGCGGTATTTGTTGAACG

Cl-PT1a-qPCR-F

GTAAATCAGGTGGCCGATGT

Cl-PT1a-qPCR-R

GGCTAAGTGCGATAGCCAAG

< For Cl-PT1b>

DGP-F1

GCNHTNTTYAARGAYATHCCNGA

DGP-F2

ATHCCNGAYRTHGARGGNGAY

DGP-R1

TTYTAYAKNTTYATHTGGAAVYT

5’RACE-R

GACTAACTGGAAAGACGAAGAAGCTCC

3’RACE-F

CATAGTTGGAGCTTCTTCGTCTTTCC

Cl-PT1b-F1

GCTCGAGATGCTTCAAATGCATTCGAGTTCAAGC

Cl-PT1b-R1

TGGATCCTCATCGTAAGAAGTGAATAAGGAGAT

Cl-PT1b-F2

ATGCTTCAAATGCATTCGAATTCAAGCTTCTCTCC

Cl-PT1b-R2

TCATCGTAAGAAGTGAATAAGGAGATATTCAGC

Cl-PT1b-qPCR-F

CGTCCCTTCGCTATGATTGG

Cl-PT1b-qPCR-R

TGCAGCGGCAGAATAGCA



CaMV35Spro-F

CACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAA

26S rRNA-qPCR-F

CCTTCGATAAGCCTGTGGAG

26S rRNA-qPCR-R

CAGACTCCTTGGTCCGTGTT

Restriction sites are underlined. In the degenerate primer sequences of Cl-PT1b (DSP-F1, DGP-F2, and R1), Y = C or T, R = A or G, K = G or T, H = A or C or T, V = C or A or G, and N = A or C or G or T.


Supplemental Table S2. Quantitative analysis of 8GU in peel of various citrus species.




Common name

Swingle's classification system

Tanaka's classification system

8GU content in peel (mg.kg-1 FW)

Mexican lime

C. aurantifolia (Christm.) Swing.

C. aurantifolia (Christm.) Swing.

N. D.

Brazil sweet lime  

C. aurantifolia (Christm.) Swing.

C. limettioides Tan.

N. D.

Macrophylla or  Alemow  

C. aurantifolia (Christm.) Swing.

C. macrophylla Wester

N. D.

Excelsa  

C. aurantifolia (Christm.) Swing.

C. excelsa Wester

N. D.

Palestine sweet lime  

C. aurantifolia (Christm.) Swing.

C. limettioides Tan.

N. D.

Coppenrhad lime

C. aurantifolia (Christm.) Swing.

C. aurantifolia (Christm.) Swing.

N. D.

Tahiti lime  

C. aurantifolia (Christm.) Swing.

C. latifolia (Yu. Tan.) Tan.

N. D.

Bears lime  

C. aurantifolia (Christm.) Swing.

C. latifolia (Yu. Tan.) Tan.

N. D.

Gallet  

C. aurantifolia (Christm.) Swing.

C. aurantifolia (Christm.) Swing.

N. D.

Giant Key lime

C. aurantifolia (Christm.) Swing.

C. aurantifolia (Christm.) Swing.

N. D.

Castagnaro Bergamote

C. aurantifolia var Bergamia

C. bergamia Risso and Poit.

N. D.

Maroc sour orange  

C. aurantium L.

C. aurantium L.

N. D.

Bouquettier de Nice sour orange  

C. aurantium L.

C. aurantium L.

N. D.

Granito Sour orange  

C. aurantium L.

C. aurantium L.

N. D.

Chinotto  

C. aurantium L.

C. myrtifolia Raf.

N. D.

Mountain

C. halimii B.C. Stone (Tan. Class.)

C. halimii B.C. Stone

N. D.

Combava  

C. hystrix D.C.

C. hystrix D.C.

N. D.

Yuzu  

C. ichang austera ex. Tan. hybrid

C. junos Siebold

3,23 ± 0,68

Ichang

C. ichangensis Swing.

C. ichangensis Swing.

N. D.

Khazi  

C. latipes (Swing.) Tan.

C. latipes (Swing.) Tan.

N. D.

Marrakech lime

C. limon (L.) Burm. f.

C. limetta Risso

1,18 ± 1,25

Pipless pummelo  

C. maxima (Burm.) Merr.

C. maxima (Burm.) Merr.

N. D.

Pink pummelo  

C. maxima (Burm.) Merr.

C. maxima (Burm.) Merr.

N. D.

Chandler pummelo  

C. maxima (Burm.) Merr.

C. maxima (Burm.) Merr.

N. D.

Kao Pan pummelo  

C. maxima (Burm.) Merr.

C. maxima (Burm.) Merr.

N. D.

Reinking pummelo  

C. maxima (Burm.) Merr.

C. maxima (Burm.) Merr.

N. D.

Tahiti pummelo  

C. maxima (Burm.) Merr.

C. maxima (Burm.) Merr.

N. D.

Deep Red pummelo  

C. maxima (Burm.) Merr.

C. maxima (Burm.) Merr.

N. D.

Corsican citron

C. medica L.

C. medica L.

N. D.

Etrog citron

C. medica L.

C. medica L.

N. D.

Buddha's hand citron

C. medica L.

C. medica L.

N. D.

Star Ruby grapefruit  

C. paradisi Macf.

C. paradisi Macf.

N. D.

Duncan grapefruit  

C. paradisi Macf.

C. paradisi Macf.

N. D.

Marsh grapefruit  

C. paradisi Macf.

C. paradisi Macf.

N. D.

Willow Leaf mandarin

C. reticulata Blanco

C. deliciosa Ten.

N. D.

Fuzhu mandarin

C. reticulata Blanco

C. erythrosa Hort. ex Tan.

N. D.

San Hu Hong Chu mandarin

C. reticulata Blanco

C. erythrosa Hort. ex Tan.

N. D.

Nan Feng Mi Chu mandarin

C. reticulata Blanco

C. kinokuni Hort. ex Tan.

N. D.

Beauty mandarin

C. reticulata Blanco

C. reticulata Blanco

N. D.

Sunki mandarin

C. reticulata Blanco

C. sunki (Hayata) Hort. ex Tan.

N. D.

Dancy mandarin

C. reticulata Blanco

C. tangerina Hort. ex Tan.

N. D.

Bendiguangju  

C. reticulata Blanco

C. nobilis Lour.

N. D.

Wase Satsuma

C. reticulata Blanco

C. unshiu Marc.

N. D.

Owari Satsuma

C. reticulata Blanco

C. unshiu Marc.

N. D.

Shekwasha mandarin

C. reticulata Blanco hybrid

C. depressa Hayata

5,37 ± 3,30

Nasnaran mandarin

C. reticulata Blanco hybrid

C. amblycarpa (Hassk.) Ochse.

10,82 ± 4,36

Cleopatra mandarin

C. reticulata var austera

C. reshni Hort. ex Tan.

N. D.

Commune Clementine

C. reticulata x C. sinensis

C. clementina Hort.ex Tan.

N. D.

Murcott tangor

C. reticulata x C. sinensis

C. reticulata x C. sinensis

N. D.

Fortune mandarin

(C. reticulata x C sinensis) x C. tangerina

C. clementina x C. tangerina

N. D.

Washington Navel orange  

C. sinensis (L.) Osbeck

C. sinensis (L.) Osbeck

N. D.

Shamouti orange  

C. sinensis (L.) Osbeck

C. sinensis (L.) Osbeck

N. D.

Hamlin orange  

C. sinensis (L.) Osbeck

C. sinensis (L.) Osbeck

N. D.

Pineapple orange

C. sinensis (L.) Osbeck

C. sinensis (L.) Osbeck

N. D.

Orange Pomeroy Trifolite

P. trifoliata (L.) Raph

P. trifoliata (L.) Raph

6,13 ± 4,97

Orange Flying Dragon Trifoliate

P. trifoliata (L.) Raph

P. trifoliata (L.) Raph

5,12 ± 5,82
















N. D., not detected.





База данных защищена авторским правом ©shkola.of.by 2016
звярнуцца да адміністрацыі

    Галоўная старонка