Sulfur alleviates arsenic toxicity by reducing its accumulation and modulating proteome, amino acids and thiol metabolism in rice leaves



Дата25.04.2016
Памер65.17 Kb.
#29297
Sulfur alleviates arsenic toxicity by reducing its accumulation and modulating proteome, amino acids and thiol metabolism in rice leaves
Garima Dixit1, Amit Pal Singh1, Amit Kumar1, Sanjay Dwivedi1, Farah Deeba1, Smita Kumar1, Shankar Suman2, Bijan Adhikari3, Yogeshwar Shukla2, Prabodh Kumar Trivedi1, Vivek Pandey1, Rudra Deo Tripathi1*
1CSIR-National Botanical Research Institute, Rana Pratap Marg, Lucknow – 226001, Uttar Pradesh, India

2CSIR-Indian Institute of Toxicology Research, Rana Pratap Marg, Lucknow – 226001, Uttar Pradesh, India

3Rice Research Station, Government of West Bengal, Chinsurah, Hooghly – 712102, West Bengal, India

*Corresponding author



Email addresses:

Garima Dixit: gariimaa21@gmail.com

Amit Pal Singh: amitcomrade@gmail.com

Amit Kumar: amit_gene@yahoo.com

Sanjay Dwivedi: drs_dwivedi@yahoo.co.in

Farah Deeba: farahnbri@gmail.com

Smita Kumar: smitabiochem@gmail.com

Shankar Suman: shankarsuman.suman@gmail.com

Bijan Adhikari: adhikaribijan@hotmail.com

Yogeshwer Shukla: yshukla@itrc.res.in

Prabodh Kumar Trivedi: prabodht@nbri.res.in

Vivek Pandey: vivekpandey64@yahoo.com

Rudra Deo Tripathi* (corresponding author): tripathird@gmail.com, tripathi_rd@rediffmail.com (Telephone: +91 (0)522 2297825; Fax: +91 (0)522 2205836 / 2205839

Supplemental Information 3
Text-S1: Material and methods

Text-S1: A- Arsenic quantification and quality control


For the estimation of As, 0.5 g oven dried tissue was taken and digested in 3 ml of HNO3 at 80 °C for 2 h and 100 °C for 4 h. Then filtered in 10 ml of Milli Q water and stored at 4 oC till the estimation. Arsenic was quantified with the help of Inductively Coupled Plasma Mass Spectrometer (ICP-MS, Agilent 7500 cx). The standard solution material of As (Agilent, Part # 8500–6940) was used for the calibration and quality assurance for each analytical batch. Recovery of As rice flour NIST 1568a was used as a reference material with known spiked samples and recovery of total As were 95.3% (2.8; n=5) and 92.5% (3.1; n=5) respectively. The detection limit of As was 1 µg L-1.

Total sulfur was estimated by Chesnin, L. and Yien, C.H. (1951). A suitable aliquot was taken in 50 ml test tube and volume was made 2.5 ml with glass distilled water. To this aliquot, 2.5 ml sodium acetate buffer pH 4.8, 2.0 ml of 50% glycerol and 5.0 ml of 20% barium chloride were added one after the addition of barium chloride. A reagent blank was also run with each set of estimation. The turbidity of the solution was measured within half an hour of reaction using violet filter on spectrophotometer. Concentration of sulfur was estimated by referring the reading to a standard calibration curve prepared from AR grade sodium sulfate within the range of 50-250 µg sulfur.


Text-S1: B- Amino Acid Profiling

The pico tag kit from Waters (Milford, MA, USA) was used for estimation of AAs on Waters–HPLC system (Bidlingmeyer et al. 1984). 0.2 g of homogenized rice plant samples were hydrolysed in 10 ml of 6 N HCl in an oven for 1 hour at 150 ºC. 10 µl of filtered hydrolysed samples (Flow chart) and of standard (2.5 µmoles/ml in 0.1 N HCl) were derivatised with phenylisothiocynate (PITC) in vacuum oven at 55 ºC for 30 mins at 75 milli torr after three rounds of drying and redrying. The derivatised samples were then diluted with pico tag sample diluent and filtered with syringe filters. 20 µl of this was then injected into the system. Chromatographic analysis of the extracts was performed with a Waters Binary gradient HPLC system with accessories module 2475, (Waters, Milford, MA, USA) equipped with a degasser (DG2), a binary pump module (515), Temperature control module (TC2), Pump control module (PC2) and a photodiode array detector (Waters 2998). The separation was carried out at 40°C using a Pico Tag amino acid C18 column (3.9 x 15 cm; 5 µm). For each sample, 20 µl of extract was injected and the column was eluted at 1 ml min-1, with an optimized gradient established using solvents A (0.14 M sodium acetate, containing 0.05% triethylamine and 6% acetonitrile, pH 6.40) and B (60% acetonitrile in water). A step-by-step gradient was used with an increase of proportion of solvent B until it reached 46% during 10 min, followed by an increase upto 100% in 5 min, with a flux of 1 ml min-1. The column was then cleared and optimised to 100% A for 8 min at 1 ml min-1.

The AAs analysed were aspartic acid (Asp), glutamic acid (Glu), serine (Ser), glycine (Gly), histidine (His), aginine (Arg), threonine (Thr), alanine (Ala), proline (Pro), tyrosine (Tyr), valine (Val), methionine (Met), cysteine (Cys), isoleucine (Ile), leucine (Leu), phenalanine (Phe) and lysine (Lys). Tryptophan (Trp), asparagine (Asn) and glutamine (Gln) could not be analysed by this procedure as these are heat labile. Chromatograms were integrated using Empower 2 HPLC software v6.0.
Text-S1: C- Estimation of thiol compounds and enzymes

For the estimation of cysteine, plant material (500 mg) was homogenized in 5% chilled perchloric acid and centrifuged at 10000g for 10 min at 4oC. Cysteine content was measured in supernatant using acid–ninhydrin reagent at 560 nm according to the method of Gaitonde (1967). NP-SH content was measured by following the method of Ellman (1959). For which, plant material (700 mg) was homogenized in 6.67% 50-sulfosalicylic acid. After centrifugation at 10 000g for 10 min at 4 °C, NP-SH content was measured in the supernatant by reaction with Ellman reagent. The level of GSH was measured by following the protocol of Hissin and Hilf (1976). Plant material (500 mg) was frozen in liquid nitrogen homogenized in 0.1 M sodium phosphate buffer (pH 8.0) containing 25% meta-phosphoric acid. The homogenate as centrifuged at 20000g for 20 min at 4oC and GSH content was determined fluorometrically in the supernatant after 15 min incubation with o-phthaldialdehyde (OPT). Fluorescence intensity was recorded at 420 nm after excitation at 350 nm on Hitachi Fluorescence Spectrophotometer (F-7000).

Assay of CS (EC 2.5.1.47) activity, plant material (1 g) was extracted in 50 mM phosphate buffer (pH 7.5) containing 1 mM EDTA, 5 mM MgCl2, 2 mM dithiotheritol (DTT), 0.1% Triton X-100 and 0.5 mM PMSF (Harada et al. 2001). The homogenate was subjected to centrifugation at 16,000 × g for 15 min at 4ºC and the supernatant was used for enzymatic assay. The CS activity was determined in the reaction mixture (0.5 ml) containing 50 mM phosphate buffer (pH 8.0), 4 mM sodium sulfide (Na2S), 12.5 mMO-acetyl L-serine (OAS) and a suitable aliquot of enzyme extract (Saito et al. 1994). The incubation was performed at 30ºC for 20 min and reaction was terminated by the addition of 0.1 ml of 7.5% TCA. The amount of cysteine synthesized in the resulting mixture was determined spectrophotometrically by the method of Gaitonde (1967) as described in section 5.1.1. The activity of CS is expressed as nmol cysteine min-1 mg-1 protein.

Activity of GR (EC 1.6.4.2) was assayed by following the method of Smith et al. (1988). The reaction mixture contained 1.0 mL of 0.2 M potassium phosphate buffer (pH 7.5) containing 1 mM EDTA, 0.5 mL 3 mM 5,5 0-dithiobis (2-nitrobenzoic acid) in 0.01 M phosphate buffer (pH 7.5), 0.25 mL H2O, 0.1 mL 2 mM NADPH, 0.05 mL enzyme extract and 0.1 mL 20 mM GSSG. The components were added in the order as above directly to a cuvette and the reaction was started by the addition of GSSG. The increase in absorbance was monitored for 5 min at 412 nm. The rate of enzyme activity was calculated using standard curve prepared by known amounts of GR (Sigma, USA). The rate of enzyme activity was expressed as l moles GSSG reduced min-1 mg-1 protein.

Glutathione S-transferase (GST) activity was assayed in fresh roots and leaves. Sample extracts (10%) were prepared in 0.1 M phosphate buffer (pH ¼ 6.5). A reaction mixture containing 2.25 mM GSH and 2.25 mM 1-chloro-2,4-dinitrobenzene (CDNB) was freshly prepared and used within 20 min of preparation. The mixture (200 mL) was transferred into each microplate well followed by 25 mL aliquot of the sample. Absorbance was measured at 340 nm for 6 min at 37 C using a Spectramax 190
ultraviolet (UV) spectrophotometer. Measurement intervals of 15 s with 5 s shaking before each reading were programmed. Reagent blanks, containing phosphate buffer instead of sample, were also prepared and measured similar to samples. All samples and blanks were assayed in triplicate.

For the assay of γECS (EC 6.3.2.2), plants were homogenized in 100 mM Tris–HCl (pH 8.0) containing 5 mM EDTA, and 1% polyvinylpyrrolidone (PVP). The reaction mixture contained 0.1 M Tris–HCl (pH 8.0), 150 mM KCl, 2 mM EDTA, 20 mM MgCl2, 5 mM Na2ATP, 2 mM phosphoenol pyruvate, 10 mM L-glutamate, 10 mM L-α-aminobutyrate, 0.2 mM NADH, 7 Uml−1 pyruvate kinase (ICN, USA), and 10 Uml−1 L-lactic dehydrogenase (Sigma, USA; Seelig and Meister 1984). The definition of 1 U activity of the enzymes used for this and other assays is the amount of enzyme catalyzing the conversion of 1 µmol of substrate to product per minute. The reaction was initiated by the addition of enzyme extract. The activity of γECS was determined from the rate of formation of ADP (assumed to be equal to the rate of NADH oxidation; ε=6.2 mM−1 cm−1, monitored at 340 nm).



Reference

Bidlingmeyer B. A., Cohen S. A., & Tarvin T. L. (1984) Rapid analysis of amino acids using pre-column derivatization. Journal of Chromatography B: Biomedical Sciences and Applications 336, 93-104.

Ellman G. L. (1959) Tissue sulfhydryl groups. Archives of biochemistry and biophysics 82, 70-77.

Gaitonde M. K. (1967) A spectrophotometric method for the direct determination of cysteine in the presence of other naturally occurring amino acids. Biochem. J 104, 627-633.

Harada E., Choi Y. E., Tsuchisaka A., Obata H., & Sano H. (2001) Transgenic tobacco plants expressing a rice cysteine synthase gene are tolerant to toxic levels of cadmium. Journal of Plant Physiology 158, 655-661.



Hissin P. J., & Hilf R. (1976) A fluorometric method for determination of oxidized and reduced glutathione in tissues. Analytical biochemistry 74, 214-226.

Saito K., Kurosawa M., Tatsuguchi K., Takagi Y., & Murakoshi I. (1994) Modulation of cysteine biosynthesis in chloroplasts of transgenic tobacco over expressing cysteine synthase [O-acetylserine (thiol)-Iyase]. Plant Physiology 106, 887-895.

Seelig G. F. & Meister A. (1984) Gamma-glutamylcysteine synthetase. Interactions of an essential sulfhydryl group. Journal of Biological Chemistry 259, 3534-3538.

Smith I. K., Vierheller T. L., & Thorne C. A. (1989) Properties and functions of glutathione reductase in plants. Physiologia Plantarum 77, 449-456.

Caldana C., Scheible W. R., Mueller-Roeber B., Ruzicic S. (2007) A quantitative RT-PCR platform for high-throughput expression profiling of 2500 rice transcription factors. Plant Methods 3, 7.


Table S1: Primer sequences for qRT-PCR analysis

Protein number

Description

Gene ID

Primers

2

photosystem II 10 kDa polypeptide

Os08g10020 F

CCTTCCGTCCATCTCCCGC

Os08g10020 R

GCGAGTAGATTGGGCTGTA

16

2Fe-2S iron-sulfur cluster binding domain containing protein

Os08g01380 F

GGTTGCCGATGTCCCTGCG

Os08g01380 R

ATCCCTTCCTCCTCCGCCTG

28

triosephosphate isomerase

Os09g36450 F

GGAAGTGCAATGGAACGAAGGAC

Os09g36450 R

GCAGCCAATGTCCACCAAT

29

ribulose-phosphate 3-epimerase

Os03g07300 F

TGGAGGTGGCAGGATGTGACT

Os03g07300 R

GTAGATGGATGGTTGACGATTGC

39

glyceraldehyde-3-phosphate dehydrogenase

Os04g38600 F

GAATGCCACCTCCGACGACT

Os04g38600 R

TACTTGAGGAGGTGCGACG

45

oxygen-evolving enhancer protein 1

Os01g31690 F

GGCTTACCTTCGACGAGATTC

Os01g31690 R

GGGTCATGAGCTTGGTCTT

50

ferredoxin--NADP reductase

Os02g01340 F

GGAGGTGACTACTAAGGTGGAGAAG

Os02g01340 R

ATGGAGTAGAGGCGGAGCTTGTG

56

phosphoribulokinase/Uridine kinase family protein

Os02g47020 F

AGCAACAGGAGGGGTAGCAC

Os02g47020 R

GAGTGTGTTTGAGTCTGGGTTGCC

58

fructose-bisphospate aldolase isozyme

Os11g07020 F

ATGGCGTCTGCTACTCTCCTCAAG

Os11g07020 R

CCCCTTCCTGGTGATGCAA

64

aminotransferase, classes I and II, domain containing protein

Os07g01760 F

AGGTGCTTACAGTGATTCCCG

Os07g01760 R

GGAAATGGCAGCAGAATAAAGCGGG

66

glutamine synthetase, catalytic domain containing protein

Os04g56400 F

CTCAGAAGCAAATCAAGGAC

Os04g56400 R

CGTTTGTTAGTAGGGATGGG

69

glutamine synthetase, catalytic domain containing protein

Os02g50240 F

TCCCCACCAACAAGAGGCA

Os02g50240 R

CAGGGAAGCCACCAACAGG

85

ATP synthase

Os06g45120 F

GGTGGAGATCTATATGCTACTGTG

Os06g45120 R

AGAAGAGGCGTGTCAGCAGC

125

glyceraldehyde-3-phosphate dehydrogenase

Os03g03720 F

TGCTGGCACGAACGCGAGAAC

Os03g03720 R

GAGCAGTGATGATGACCTTCTTCGC

136

aminotransferase

Os08g41990 F

GCCCATTGTGTTTGATTCTGTG

Os08g41990 R

CTCAGCCAACACATTCTCCAACAC

Control

Actin

Rice actin F

GGAAGTACAGTGTCTGGATTGGAG

Rice actin R

TCTTGGCTTAGCATTCTTGGGT


Fig S1: Observable effects of different S doses under arsenic stress on leaves of rice (Oryza sativa L.) plant. The photographs of the same samples were taken at each treatment concentration point, and photographed enlarged.



Fig. S2: Effect of different S doses on arsenite stress in leaves of rice (Oryza sativa L.) plant at (A) length; (B) weight; (C), values are the average of 15–20 plants. Chlorophyll a; (D) chlorophyll b; (E) total chlorophyll; (F) carotenoid. All the values are means of triplicate ± S.D. ANOVA significant at p ≤ 0.01. Different letters indicate significantly different values at a particular treatment (DMRT, p ≤ 0.05).



Fig. S3: Expressional changes of genes (proteins of glycolytic pathway, photosynthesis and energy metabolism) at the mRNA level in rice (Oryza sativa L.) leaves. The x-axis stands for locus ids of genes and their corresponding protein spots are given in Table S1. The values are means of three replicates ± SD. ANOVA significant at p ≤ 0.01. Different letters indicate significantly different values at a particular treatment (DMRT, p ≤ 0.05).

Fig. S4: Hierarchical clustering of S responsive proteins, analysis was conducted using MeV software.






Каталог: article-assets -> npg -> srep -> 2015
2015 -> Taxus chinensis in the fruiting season of 2011 and 2012
2015 -> Identification of common horsetail Equisetum arvense
2015 -> High nutrient-use efficiency during early seedling growth in diverse Grevillea species (Proteaceae)
2015 -> S. Uthicke, J. Doyle, S. Duggan, N. Yasuda, A. D mcKinnon
2015 -> Supplementary information Strong phylogenetic signals and phylogenetic niche conservatism in ecophysiological traits across divergent lineages of Magnoliaceae
2015 -> Figure 3 legend Figure Phylogenetic position of the
2015 -> Life history and dynamics of a platypus (Ornithorhynchus anatinus) population: four decades of mark-recapture surveys
2015 -> Transcriptome profiling revealed changes of multiple genes involved in defense response in Polyporus umbellatus with Armillaria mellea infection
2015 -> Supplementary Table S6: List of evaluated literature. Part A: 253 review and research papers on biomarkers


Поделитесь с Вашими друзьями:




База данных защищена авторским правом ©shkola.of.by 2022
звярнуцца да адміністрацыі

    Галоўная старонка