Molecular Cell, Volume 27 Supplemental Data Repeat Organization and Epigenetic Regulation of the dh-c Domain of the Immunoglobulin Heavy-Chain Gene Locus Tirtha Chakraborty, Dipanjan Chowdhury, Amanda Keyes, Anant Jani, Ramesh Subrahmanyam, Irina




Дата канвертавання19.04.2016
Памер65.76 Kb.
Molecular Cell, Volume 27

Supplemental Data

Repeat Organization and Epigenetic Regulation

of the DH-C Domain of the Immunoglobulin

Heavy-Chain Gene Locus

Tirtha Chakraborty, Dipanjan Chowdhury, Amanda Keyes, Anant Jani, Ramesh Subrahmanyam, Irina Ivanova, and Ranjan Sen

Table S1A.

Table S1B.

Table S2.


Primer list:1


Chromatin Immunoprecipitation primers


DF(-10) 5’

CAA GGG CAA CAG TAA CTA TGA TGT GTC

DF(-10) 3’

CAG TCT GCC TTA CTC CTT TCT CAG C

DF(-6) 5’

CCC AAC CCA CCC ACT CCT AC

DF(-6) 3’

AAG CAA TAC CTC CCC AGA GC

DF(-4) 5’

CCT CCT TGA CAG CCT TGG GG

DF(-4) 3’

GTC ACT CCC TCC TCC CTG TTG

DF(-1.8) 5’

TAGCTCTAGTTCATTCTATGTTTCAGACC

DF(-1.8) 3’

ACATTCCCCATCTGTGGTGCT

DFL16.1 5’

CAA AGC AGC CAC CAT CCA G

DFL16.1 3’

GCA GCA CGG TTG AGT TTC AG

DF(+1) 5’

GTC CCC CTC TGA CTC CTA TTG G

DF(+1) 3’

AGT TAC TAT CCC TAA GTC TCT GTG GC

DF(+3.5) 5’

GAA GCC ACA CAC ATC TGA GGA GG

DF(+3.5) 3’

GAT GGA CAC ACA GTT GCC TCT TTC

DSP2(-0.5) 5’

CCA CTA CCA GGA CCC CAC TAC C

DSP2(-0.5) 3’

GGC TGT CTA CTT ATT TTT CTG CTG CTC

DSP2 5’

CAA CAA AAA CCC AGT ATG CCC AG

DSP2 3’

GTG CTT TCA CCT GTC TGT GGG

DSP2(+1) 5’

CCT CAG CAG CCA CTT CCA G

DSP2(+1) 3’

GGT CAT CAA AGA CAC AGG ACA TTC TC

DQ(-3) 5’

TCA ATA GGG TGG GCT GAT GC

DQ(-3) 3’

TGG CAA GCA AGC AAG TTT CC

DQ(-1) 5’

AGC AGA ATC CCA GCC AGG AG

DQ(-1) 3’

GGG TGA ATA GGA AAG GTG GTG TC

DQ52 5’

CCC TGT GGT CTC TGA CTG GTG

DQ52 3’

GAT TTC TCA AGC CTC TCT ACT TCC TC

DQ(+0.5) 5’

CCC AGG AAA AGA GGC AGT CAG

DQ(+0.5) 3’

GCC CCA GTA GTC AAA GTA GTC ACA C

JH1FP

GCTCAGGTCACTCAGGTCAGG

JH1RP

GAGAATATCTTTTCCCGTTTCAGA

JH2FP

TACTTTGACTACTGGGGC

JH2RP

CCCTAGTCCTTCATGACC

Eμ(+1) 5’

GAC CCA GGC TAA GAA GGC AAT C

Eμ(+1) 3’

ATC TAA GCA CTG TCC TTT GAT ACC ATT C

Cμ 5’

ATG TCT TCC CCC TCG TCT CC

Cμ 3’

TAC TTG CCC CCT GTC CTC AG

Cμ(+2) 5’

CCA AGG CTC ACG GCT CAG

Cμ(+2) 3’

TGG GTG GTT AGT GGA GTA TCT TCT G

Cμ(+4) 5’

GGA AGG ACA GCA GAG ACC AAG AG

Cμ(+4) 3’

GGG CCA GAC ATT GCT TCA GAT TG

Cδ 5’

ACC CCA AGG CTG TCC AAT G

Cδ 3’

GCA AGG AGA AGT GGC AAG AGG

C3 5’

tggacaaacagaagtagacatgggtc

C3 3’

ggggtttagaggagagaaggcac

DFL-1.7 F

acagtgtacCCAAAGGCAGCACCAC

DFL-1.7 R

GGTGGGATCAGTGCCCATCTTACTG

DFL-1.2F

GTCCCTACCTCATGTGGGTGCTGCG

DFL-1.2R

CTACACTAACTTTTAAAATTCCTACT

DFL-700F

gggaTTCCCTGTCACTGGACTTCAC

DFL-700R

GTGGGGCACTGTCAACACAAGGTTC

DFL-300F

catagcctgtgaggCTTTCTGACAG

DFL-300R

gaaggctgtgtggttttgCTGTGAG

DFL-100F

GATAGAAGCACAGAAGTGAATAATC

DFL-100R

ggtTTTGCAGGTGTAGAGAGCATTG

Rec DFL FP

accgtgctgcctgggcccccaatgc

DSP2.2(2)-1kbF

TGTCCAGTAGAAAGGTGCACATG

DSP2.2(2)-1kbR

ATATTTGGGTTTCAGTGCTGATGACC

DSP2.2(2)-500F

ACAAGAACTTGTAAAGAGCAGC

DSP2.2(2)-500R

TCCTCACAGACGATGCAGATCTTAC

DSP-2.2(2)-200 F

CAGCATGGTGGTCAGGAAGTCG

DSP-2.2(2)-200 R

cacaacactgacttcacaacatccC

DSP 2.2(2)-100 F

Ccctggggagatagaatcccaggag

DSP2.2(2)-100 R

aatccctgccaagtaaggtaagagat

DSP2.2(2)F

CAGGCAATGTTCCTGCAGAATCTC

DSP2.2(2)-1.4kb F

tccagtccacactcatcaccttggc

DSP2.2(2)-1.4kb R

GTTGCTCTCCTTTAGCCCAAGTTCTG

DSP2.2(2)-2.4 F

GTCTTACCCACCCCTGCCCCCAAGA

DSP2.2(2)-2.4 R

ATATCCGGAAATCTGTTTCCCTC

DSP2.11-1.1 FP

GAGTAGGAATTTTAAAAGTTAATGG

DSP2.11-1.1 RP

ACCCTCTGGAGAATTTCTGCCTTTC

DSP2.11 RecF

Gttcctgcagaacctgttaccttac

DSP2.11-100 FP

Caagggatgttgggaagacagac

DSP2.11-100 RP

GGCCATCCTTAATATACATCCAAC

DSP2.11-600RP

Agatgagaagagcatatctgagc

DSP2.11-600FP

TGAAGTTGTGACAGTTGTCTCCTTT

DSP 2.11-1.5 FP

AATTCATCCACTTCATAAACCAAT

DSP 2.11-1.5 RP

TCTGCCTTTCAGCCCCTCTTCT

Rec JH1R

ACGGTGACCGTGGTCCCTGCGCC

Rec JH3R

TGC AGA GAC AGT GAC CAG AGT CCC

Maj sat FP

Taggacgtgaaatatggcgagg

Maj sat RP

Cttgccatattccacgtcctac

-actin FP

GACACCCAACCCCGTGACG

-actin RP

GCGGCCATCACATCCCAG

-globin FP

GCCTTGCCTGTTCCTGCTC

-globin RP

CAGACCATAAACTGTATTTTTCTTATT

EFP

GAATGGTAGTGGGGAAATCT

ERP

TCGGTCAGGGAAACAAGTAT

 2 microglobulin FP

GCGGTCCCAGGCTGAACGACCAG

 2 microglobulin RP

GAGAGACCAGCTAGGGCGCGCG

Primer list: 2


Sterile Transcript Analysis Primers

γ-actin FP




Real Time PCR Primers
GGT GTC CGG AGG CAC TCT T

γ-actin RP

TGA AAG TGG TCT CAT GGA TAC CA

Cμ FP

AGA GAT CTG CAT GTG CCC ATT

Cμ RP

TGG TGG GAC GAA CAC ATT TACA

DFL16.1 FP

TGG CCA GGG CTT TTT GTG

DFL16.1 RP

TGATGGATATAGCACTGTGGTAGCTA

DSP2 FP

TGTTACCTTACTTGGCAGGGATTT

DSP2 RP

TGG GTT TTT GTT GCT GGA TAT ATC

DQ52 FP

TGG TGC AAG GTT TTG ACT AAG C

DQ52 RP

CCA AAC AGA GGG TTT TTG TTG AG

DFL-1.7 FP

Ggcgaagaagcttgtatcacat

DFL-1.7 RP

gtgggtgggatcagtgcccatctta

DFL-4.5 FP

aggcatctcatctcactctaagc

DFL-4.5 RP

tgtgtccctctaagacgagtgaat

DFL16.1 +3 FP

cggccatgcaccaga

DFL16.1 +3 RP

tgtgtgactgatggtcagaagga

BTWDSP FP

ttggtggatctcacctcctgtga

BTWDSP RP

ctccctcctcaggctcctcta

DQ52-3 FP

gatgcccaagaatcattaggctat

DQ52-3 RP

tctccccaagaccgacctt

DSP2.9 FP

CCTAAGGGACTATATCTTGGTCACATG

DSP2.9 RP

GATCTATGTCAATATCTGTCCCATAGCT

DSP-1 FP

CAG CAC TGA ACC CCA AAT ATG TAC C

DSP-1 RP

CTC AAT TTG TTT ATA CTT CTT CGG G

DSP+1 FP

CTT TGA TGA CCT GAC CCT TAG GCT C

DSP+1 RP

ACA AGA ACA CTC TTC AGG GGC ATT

DFL-4.5 S




Strand Specific Primers
ttttggcttgtttaattggcttg

DFL-4.5 AS

Cactaagtgtgtttagaaagatctc

DFL-1.7 S

Ctatatcaccccgtatgagcc

DFL-1.7 AS

ggaaacataggaccaatttaagatg

DFL16.1 S

tggttcatgtggttttctgctg

DFL16.1 AS

cccagagacagaccattccagt

DFL+3 S

caacctctcctgtgtgcatctg

DFL+3 AS

agagagcagcagcaagttcaaaa

DSP2 S

ttcttattaaggaggcactggt

DSP2 AS

gcagcatgtcggtcaagaagt

Btw DSPs S

ttctgcaatctgatatttaatagtggc

Btw DSPs AS

cccaagtagaatatgatccacaattaca

DQ-3 S

caaattgggccagtcattgg

DQ-3 AS

tatgtaatctcactcaggatgatatttttct

DQ52 S

ggatcctcttggtaagtccttgg

DQ52 AS

ccatcacagacctttctccatagt

C S

Cgtggcctacaacacaggtat

C AS

Gagtcagtccttcccaaatgtc

-Actin S

catcgtgctaggtgctagggc

-Actin AS

gagcaagaaatggctactgctg

DFL-100 AS

Tcagcctagaggcaggctcag

DFL-300 AS

Agggagacgagggttaggacacaac

DFL-300 S

Gataagaactactggaatggtc

DFL-700 AS

AGTAAAGAAGGATTGTAAGGATT

DFL-700 S

Gttgtgtcctaaccctcgtctccc

DFL-1.2 AS

Gtaggaaggcattggactctcag

DFL-1.2 S

TATTATGCAGAGGATCCTGAGT

DFL-1.7 AS

Ttgggacatgtaaactgtaacagg

DFL-1.7 S

AGGAGGTTCTTTGGCCTGTTT

DSP2.2(2)-1kb AS

TACTGTTGCGACACTCAGTTATG

DSP2.2(2)-1kb S

ACCAATATGTTTATACTTCTTTGG

DSP2.2(2)-500 AS

ACAAAGACTAGGGTGAAGAGGGTT

DSP2.2(2)-500 S

CAGACAGCATCCCAAGCCAGGCA

DSP-2.2(2)-200 AS

TGCCTGGCTTGGGATGCTGTCTG

DSP-2.2(2)-200 S

ctcctgggattctatctccccaggG

DSP2.2(2)AS

CAAGGGATGTTGTGAAGTCAGTG

DSP2.11-1.5 AS

Agccttccacacgttgtaggaatgg

DSP2.11-1.5 S

Cattgtcaggtagttctgtctgagc

DSP2.11-600 S

Atgcagatctttcctttaagactgg

DSP2.11-600 AS

Catgttcaacaggattgcctctcac

DSP2.11-100 S

Attgtctggtggggccagaggtagc

DSP2.11-100 AS

Catccagaaacagacctctccaatg

rDNAFP

CCTGTGAATTCTCTGAACTC

rDNARP

CCTAAACTGCTGACAGGGTG

γ-actin




Fam/Tamra Probes
AGCCTTCTTTCCTGGGCATG



CAGCTGTCGCAGAGATGAACCCCA

DFL16.1

AGGGATCTACTACTGTGTTTATTACTACGG

DSP2

TGTCAAGGGATCTACTACTGTGCCTAG

DQ52

CACCACAGTGCAACTGGGACCACG

DFL-1.7

agagtgttgcccaatgactatttgctatcttcaca

DFL-4.5

cctttgtttccagcagttcagcctcaagc

DFL+3

AAGCATCTAAAGAGCTACCAGGACATGAAC

Btw DSPs

acacacatctacacgtgatttagtgcc

DQ-3

AATAATGGCAGGAAAGGCATATCAGCAGC



Figure S1.

Figure S2.



Figure S3.





Figure S4.



Figure S5.



Figure S6.




Figure S7.


Figure S8.


Figure S9.





База данных защищена авторским правом ©shkola.of.by 2016
звярнуцца да адміністрацыі

    Галоўная старонка