Left primer ctgcagagggtgattttgct right primer attgtgcatcaccagccatt sequence size




Дата канвертавання24.04.2016
Памер26.2 Kb.
Additional file 1 Primers used in RT-qPCR and a table representing expression of HC-Pro mRNA in transgenic plants measured using RT-qPCR.
Primers for reference genes:
EB450395; Nicotiana tabacum ARPC3 (actin-related protein C3)

LEFT PRIMER CTGCAGAGGGTGATTTTGCT

RIGHT PRIMER ATTGTGCATCACCAGCCATT

SEQUENCE SIZE: 84


X67159; Nicotiana tabacum Nicotiana tabacum pectate lyase mRNA

LEFT PRIMER TGGGAAAGGTACGCTATTGG

RIGHT PRIMER TCGCACCATTTTCCATATCA

SEQUENCE SIZE: 184


Primers for differentially expressed genes:
TG-HcPro; Primer pair for testing HC-Pro expression

LEFT PRIMER TGGGGGTTATGGATTCAATG

RIGHT PRIMER CATTATCGCTGCAACTCTGC

SEQUENCE SIZE: 152


AY772945; Nicotiana tabacum pectin methylesterase mRNA, complete cds

LEFT PRIMER TTTCGTGTTTGGTGATGCAG

RIGHT PRIMER GAAACGCCTTCATTTGTGGT

SEQUENCE SIZE: 197


FG156808; Nicotiana tabacum P-rich protein NtEIG-C29

LEFT PRIMER CATCTGGCTTCCAGTGTCCT

RIGHT PRIMER CGTCCCCTAGAAAACCCTGT

SEQUENCE SIZE: 287


FG157361; Nicotiana tabacum RAV mRNA

LEFT PRIMER GCCCTTGCTTGAAAATGAAG

RIGHT PRIMER GGGAAATGTTTTTCAGCATGT

SEQUENCE SIZE: 404


EB438380; Solanum lycopersicum Trypsin and protease inhibitor

LEFT PRIMER CCTAGTGCCACATCACGTTG

RIGHT PRIMER GCAATACATTGCTGGGAGTTT

SEQUENCE SIZE: 428


EH620344; Arabidopsis thaliana FKF1

LEFT PRIMER TCTTGCTGTTTGTAGTCCCTTG

RIGHT PRIMER AGAATATATAAATACAACGGCAAAAAG

SEQUENCE SIZE: 166


EH615198; Nicotiana tabacum nictaba (NT1)

LEFT PRIMER GGCTTCGATATTCGTCCAAA

RIGHT PRIMER TCACATGCACTTACAACAAGCTC

SEQUENCE SIZE: 211


FG156808; Nicotiana tabacum 1-D-deoxyxylulose 5-phosphate synthase

LEFT PRIMER CCTAGAGGAAATGGAGTTGGTG

RIGHT PRIMER GATGTCTGCAGCTCCCAAA

SEQUENCE SIZE: 210


Nicotiana tabacum S-Adenosyl-L-methionine methyltransferase (SAMT)

AY741503


LEFT PRIMER AAGCATGGGTTTCAATCACC

RIGHT PRIMER ACAACCAACTCATTGAGGGC



SEQUENCE SIZE: 228


Expression of HC-Pro mRNA in transgenic plants measured using RT-qPCR. Numbers are indicating quantification cycle (Cq) values. No PCR products were detected in wild type samples (N/A).




Leaf

Leaf

Leaf

Flower

Samples (WT)

WT2

WT3

WT4

WT2

Technical replicate 1

N/A

N/A

N/A

N/A

Technical replicate 2

N/A

N/A

N/A

N/A

Technical replicate 3

N/A

N/A

N/A

N/A

Technical replicate 4

N/A

N/A

N/A

N/A

Sample (HC-Pro)

HC-Pro1

HC-Pro2

HC-Pro3A

HC-Pro1

Technical replicate 1

18.85

20.38

26.15

18.15

Technical replicate 2

19.21

20.75

26.68

18.25

Technical replicate 3

19.09

20.39

26.9

18.74

Technical replicate 4

19.14

20.85

26.82

18.44

Mean

19.0725

20.5925

26.6375

18.395

s.e.

0.078142

0.12154

0.168739

0.129775

Three biological replicates of leaf samples (WT and HC-Pro) and one flower sample (WT and HC-Pro) are presented in the columns. Four technical replicates are also shown.


База данных защищена авторским правом ©shkola.of.by 2016
звярнуцца да адміністрацыі

    Галоўная старонка