Homo sapiens 1 meaetg-ssv

Дата канвертавання25.04.2016
Памер85.81 Kb.


Pan troglodytes 1 ......--....--.......................................................................................................... 116

Macata mulatta 1 ......--....--...R............................................................................D......................... 116

Equus caballus 1 ....A.--..M.--...T.........I.SI....A...........F.............................................DS......................... 116

Bos taurus 1 ......--..M.--I..T.........A..........IV....CS.F.V.NSG-----..-.QD...S........................HS...........I.....R....... 110

Mus musculus 1 ......--.TM.--...GT...I....AL.I........L..........F...................M..........E...................................... 116

Rattus norvegicus 1 ....A.--.TM.--...GT...I....AL.IT.......L..........F...................M..........E...................................... 116

Monodelphis domestica 1 ....A.--KNAKQG...T..KAI.....I.IT..A....L.......F.N.RV..K...T.....V.......I.Q.....E...Q.......KD...........I.....R....... 118

Canis familiaris 1 1 ..T.M.--..A.--...T.........A..I.......M........F...........................F.................N.......................... 116

Canis familiaris 2 1 ..T.M.--..A.--...T.........A..I.......M........F...........................F.................N.......................... 116

Ornithorhynchus 1 ....AAQKA.LG--....SGKA..V.......C.A....L.......Y.NF...P....TSD......S....I.Q.....E.......E...DA......................R.. 118

Gallus gallus 1 ..G..V--PA----SRRA..KA.....G...A..IA...A...-----------------------...V...I.Q........Y........Y........SN.........S...... 91

Tetraodon nigroviridis 1 QE.F..S.......GS....IDP..N...D.YT...G...KE......SS...I.....QE..IR.. 67


Pan troglodytes 117 .................................R...................................................................................... 236

Macata mulatta 117 .....................................R...........................................................S...................... 236

Equus caballus 117 A....................................................................................................................... 236

Bos taurus 111 A............................................................................................S...M...........A.......... 230

Mus musculus 117 A.....V........V.......................................A..............................................................F. 236

Rattus norvegicus 117 A.....V........V.......................................A..............................................................F. 236

Monodelphis domestica 119 A......................V....................................................V...................R...K........S.......... 238

Canis familiaris 1 117 A.......................................................................H...A.........L..........V.S.................... 236

Canis familiaris 2 117 A.......................................................................H...A.........L..........V.S.................... 236

Ornithorhynchus 119 A...........S..V.............R.......R..................H.....T.............A....F....L................................. 238

Gallus gallus 92 A....P..K.Q.S..V.......A.....NK.....V....S....................L....R...V.....L..............AA...V..RY.......S...SS..... 211

Tetraodon nig. 68 ....-APADAAEL..VG...V..R.....TVL..L.S..M.KT.KQPE.....VGDGLKG.YQ..AGQW...K...DM.NLH.K..LV.........N.SHYVI.....S...PS....T 186


Pan troglodytes 237 ........................................................................................................................ 356

Macata mulatta 237 ..............................................................R......................................................... 356

Equus caballus 237 ...................................................................Q...................A....E....D...................... 356

Bos taurus 231 ...................................................................Q...........S.......V....E....G...................... 350

Mus musculus 237 ..T..............................................................................................G.....................A 356

Rattus norvegicus 237 ..T..............................................................................................G.....................A 356

Monodelphis domestica 239 .......A...................V...................................................S..Q.....K...D....G...................... 358

Canis familiaris 1 237 ..T.......................................S........................Q........................G....G...................... 356

Canis familiaris 2 237 ..T.......................................S........................Q........................G....G...................... 356

Ornithorhynchus 239 .............F.............AT.............M........................D...................IK.....R..G....................EA 358

Gallus gallus 212 E.T........TFLQ............A....S......K..V........Y......V.............................K...E....G.....I..............EN 331

Tetraodon nig. 187 T..SS.QA..A..LSL...V..M...PEKA.QAQ.EQA.AF.T...H.LV.Y......N...RYS..R.HRH..E.....F..R.VE.K-EDKSRS..S..H.I...........KLIN. 305


Pan troglodytes 357 ............................................................................--------..---------....I.................... 459

Macata mulatta 357 .....................................................................H......--------..---------....I.................... 459

Equus caballus 357 ...................................................................N.H.R....--------..---------....I...................T 459

Bos taurus 351 ........................................................T..........N.H......--------..---------....I.................... 453

Mus musculus 357 ...................................................................N.H......--------..---------....I.................... 459

Rattus norvegicus 357 ...................................................................N.H......--------..---------....I.................... 459

Monodelphis domestica 359 ...................L.....................I...................A.......H......--------..---------....I...........D........ 461

Canis familiaris 1 357 .....................................................................H......--------..---------....I..I................. 459

Canis familiaris 2 357 .....................................................................H......--------..VSAAPQLVR....I..I................. 468

Ornithorhynchus 359 ...................L.........................................A.......H......--------Q.---------.......I....V...H...D.... 461

Gallus gallus 332 .....L............LF.................H...S.........DLV.............KAH......--------..---------VK..S..--.------K...K...S 426

Tetraodon nig. 306 TDPRIV...VQ..T.F...TS.....L..Y.D.A..TT...S.T.R.......V.GS.S.AT.RI...KH......LVSALLRMAQ---------....I..I......I.....D...P 416


Pan troglodytes 460 ....R................................................................................................................... 579

Macata mulatta 460 ....................D...................S............................................................................... 579

Equus caballus 460 ...M....................................S............................................................................... 579

Bos taurus 454 ............................I...........S...............T............................................................... 573

Mus musculus 460 ......Q....................Y............S............................................................................... 579

Rattus norvegicus 460 ......Q....................Y............S............................................................................... 579

Monodelphis domestica 462 ....R.R.............K......Y.......M....S.......................E......................................AA............... 581

Canis familiaris 1 460 ...........................Y............S............................................................................... 579

Canis familiaris 2 469 ...........................Y............S............................................................................... 588

Ornithorhynchus 462 E...R.T.............K....E.YI......M....S..................Y....E.......................................A............... 581

Gallus gallus 427 E.....H...K..M......Q......YI...I.TL..T.SV...........A.....Y....E........S.............................................. 546

Tetraodon nig. 417 P..K..I...H...P........L.N.YL.....KLQ...K..Y...M..L.FIG...LA....T..R...............S...................K................ 536


Pan troglodytes 580 ......................................................---............................................................... 696

Macata mulatta 580 ......................................................---..................................V............................ 696

Equus caballus 580 .........................VD............V..............---..................................V............................ 696

Bos taurus 574 .........................MD...........................---..................Q...........K...V........E........M.......... 690

Mus musculus 580 .........................V............................---..................................V............................ 696

Rattus norvegicus 580 .........................VD...........................---..................................V............................ 696

Monodelphis domestica 582 ...........K..............D............VS...S.........---..............................K...V..D.....K................... 698

Canis familiaris 1 580 ..........................D............V........R.....---..............................K...V........I.N................. 696

Canis familiaris 2 589 ..........................D............V........R.....VRG..............................K...V........I.N................. 708

Ornithorhynchus 582 .........................SD........S...V........R.....---............................S.E...T..V....LE................... 698

Gallus gallus 547 ........S...............T.V................N.......S.H---.N.....A.................R..REK.G.E.......LD..H...............F 663

Tetraodon nig. 537 ..L.....S......S.....Q...NS.ITA.S...Q...D..NS...E.....VRG.R.....A........I........R..DTS.G.A..L....VGLN................. 656


Pan troglodytes 697 ......................................S.............. 749

Macata mulatta 697 ..................................................... 749

Equus caballus 697 ........................V.............S.............. 749

Bos taurus 691 ........I.A.............V.............S.......AE..... 743

Mus musculus 697 ......................................R.......A...... 749

Rattus norvegicus 697 ......................................A.......A...... 749

Monodelphis domestica 699 ........I...............V.............I.......TE..... 751

Canis familiaris 1 697 ........I...............V.............S.............. 749

Canis familiaris 2 709 ........I...............V.............S.............. 761

Ornithorhynchus 699 ...............................H......L.......AE..... 751

Gallus gallus 664 .S.S....IY.......M...I..M......R......V.TS....AE..... 716

Tetraodon nig. 657 ...T....I.S......K...I..M..Y...W...G..AS.V....AQ...V. 709

= Zinc binding aa residues and NNNN Substrate contacting sites

= Cystein involved in disulfur bonds

= missense mutation reported in this study

= other missense mutation reported in the PHEX database
NNNNNNN= transmembrane domain

Evolutionary comparison of PHEX amino acid sequences

Hom: Homo sapiens; Pan: Pan troglodytes (chimpanzee); Mac: Macaca mulatta (rhesus macaques); Equ: Equus caballus (domestic horse); Bos: Bos Taurus (domestic cow); Mus: Mus musculus (house mouse); Rat: Rattus rattus (brown rat); Mon: Monodelphis domestica (gray short-tail opossum); Can: Canis familiaris (domestic dog); Orn: Ornithorhynchus anatinus (duck-billed platypus); Gal: Gallus gallus (domestic chiken); Tet: Tetraodon nigroviridis (spotted green pufferfish)

Supplemental Table 1 : Primer design for Polymerase Chain Reaction and sequencing


Forward PCR primers

Reverse PCR primers

Sequencing primers


5’ tttcctgacggcagtttctt 3’

5’acctatgaacgcaggcaaac 3’

5’gctcttgagaccagccacca 3’


5’tgggttttggaataccgtgt 3’

5’gctccactgtttcacaccaa 3’

5’tcttgcgtatgtttccgaggg 3’


5’aaggcttggaaactggttga 3’

5’agtcatgcttcaaatcccaaa 3’

5’ttggaaactggttgatatgg 3’


5’gacttccaacttggcaccat 3’

5’tccagtctttcacaatcattcc 3’

5’ccaacttggcaccatatgtg 3’


5’ccaccccacctcttttacct 3’

5’gcaccccaaaaggctaatct 3’

5’ccacctcttttacctactcc 3’


5’catcactcttgttaacatgg 3’

5’cattgaatagccacactgctc 3’

5’catcactcttgttaacatgg 3’


5’tctgctcttccatgtctctcaa 3’

5’caatgggcaatgacacaaaa 3’

5’ctcttccatgtctctcaaacata 3’


5’atgcagatgttttggcacat 3’

5’ggcatcccaatacacagaca 3’

5’gtaatcatacagtaagaaatgg 3’


5’ggatggcaatgatcaggagt 3’

5’accgggattttccctatgac 3’

5’ctagacttgagtagttgcatc 3’


5’atgagtaagaggtccctcgat 3’

5’cccctgtctaatccctaaaga 3’

5’ctgcagagcatcagatattgac 3’


5’gggttagggtgtgcagtgtt 3’

5’gacaatacccacaggccact 3’

5’agggtgtgcagtgttttgtag 3’


5’cagagcatggagtcaagctg 3’

5’gcatgaacatccattaaacca 3’

5’agcatggagtcaagctgaaaga 3’


5’agatgaagggcgcatttctaca 3’

5’tgctaggacttgggttagtt 3’

5’tgatttaagtgctgaaactctg 3’


5’catggctttgtgacttctgg 3’

5’agagactccgcttctcacca 3’

5’tgacttctgggtcaactgataa 3’


5’gtccaacatccccattgttc 3’

5’caaccttccttcaccagcat 3’

5’agccatgctgtgtttgtctttg 3’


5’gaggagtgcctttcagatgg 3’

5’ctctaccaaagcaacatgttc 3’

5’aggtactcatcattgaatcaatct 3’


5’gcagtttatcttggctttcca 3’

5’ttattgcaagccatcacagc 3’

5’gtttatcttggctttccattgaa 3’


5’ttttgaaggcttgtcgaggt 3’

5’ttcagcaggtatggggtagg 3’

5’ggtgagggaaaggaaagatg 3’


5’ttgatgcctcttgctgaatg 3’

5’ggtcaatggggagacacact 3’

5’cagaaattccataatatctaac 3’ or

5’ggagacacacttctatttacag 3’


5’ggtgtacctgcctcactggt 3’

5’gggagcaaactcaagtcctg 3’

5’cctcactggtaagcaaacagga 3’


5’ttggagcagttaaaacagcaga 3’

5’atggaaatcacacgtccaca 3’

5’gcagttaaaacagcagaaaatac 3’


5’gggctttagttgtctccctgt 3’

5’ ctctccaggcctaaagcaatg 3’

5’agttttatacagaacctgttg 3’

22 (3’-UTR)

5’tgaacagaggcatggactcc 3’

5’agtttcattccaacagactcca 3’

5’gggacgctggtttatggcat 3’

База данных защищена авторским правом ©shkola.of.by 2016
звярнуцца да адміністрацыі

    Галоўная старонка