Electronic supplementary material – Genetic Resources and Crop Evolution Phylogenetic characterisation of Onobrychis species with special focus on the forage crop Onobrychis viciifolia Scop. Christine Hayot Carbonero1,2*, Franck Carbonero3




Дата канвертавання25.04.2016
Памер59.89 Kb.
ELECTRONIC SUPPLEMENTARY MATERIAL – Genetic Resources and Crop Evolution
Phylogenetic characterisation of Onobrychis species with special focus on the forage crop Onobrychis viciifolia Scop.
Christine Hayot Carbonero1,2*, Franck Carbonero3, Lydia M. J. Smith2 and Terence A. Brown1
1 Manchester Interdisciplinary Biocentre, Faculty of Life Sciences, University of Manchester, Manchester M1 7DN, UK; 2 NIAB, Huntingdon Road, Cambridge CB3 0LE, UK; 3 Department of Animal Sciences, University of Illinois, 1207 West Gregory Drive, Urbana, IL 61801, USA
* Current address: Department of Crop Sciences, University of Illinois, 1102 South Goodwin Avenue, Urbana, IL 61801, USA
Corresponding author

Terry Brown: e-mail terry.brown@manchester.ac.uk; Tel. +44 161 306 4173 ; Fax. +44 161 306 5201



Table S1 PCR primer sequences and annealing temperatures

Locus Primer sequences (5´3´) Annealing Reference

temperature (°C)

ITS CCTTATCATTTAGAGGAAGGAG 50 Kress et al (2005)

TCCTCCGCTTATTGATATGC
trnH-psbA GTTATGCATGAACGTAATGCTC 50 Kress et al (2005)

CGCGCATGGTGGATTCACAATCC


trnT-trnL CGAAATCGGTAGACGCTACG 50 Taberlet et al (1991)

GGGGATAGAGGGACTTGAAC



Table S2 OTU memberships

Species Accession Section Country of origin

number

Internal transcribed spacer sequences

OTU 1


O. arenaria 1312 Onobrychis Kazakhstan

O. arenaria 1318 Onobrychis Former Soviet Union

O. arenaria ssp. sibirica 1336 Onobrychis Russia

O. arenaria ssp. sibirica 1339 Onobrychis Mongolia

O. biebersteinii 1343 Onobrychis Former Soviet Union

O. cyri 1325 Onobrychis Armenia

O. cyri 1346 Onobrychis Former Soviet Union

O. gracilis 1351 Onobrychis Bulgaria

O. montana 1310 Onobrychis France

O. pyrenaica 1356 Onobrychis Spain

O. viciifolia 1001 Onobrychis United Kingdom

O. viciifolia 1012 Onobrychis Italy

O. viciifolia 1017 Onobrychis Spain

O. viciifolia 1028 Onobrychis France

O. viciifolia 1071 Onobrychis United Kingdom

O. viciifolia 1077 Onobrychis Canada

O. viciifolia 1200 Onobrychis Germany

O. viciifolia 1240 Onobrychis Zimbabwe

O. viciifolia 1246 Onobrychis Kazakhstan

O. viciifolia 1262 Onobrychis United Kingdom
OTU 2

O. alba ssp. laconica 1330 Lophobrychis Bulgaria

O. alba ssp. laconica 1332 Lophobrychis Bulgaria

O. altissima 1309 Onobrychis Iran

O. altissima 1313 Onobrychis Georgia

O. altissima 1322 Onobrychis Armenia

O. antasiatica 1263 Onobrychis Armenia

O. antasiatica 1264 Onobrychis Armenia

O. antasiatica 1265 Onobrychis Armenia

O. arenaria 1308 Onobrychis Germany

O. arenaria ssp. sibirica 1333 Onobrychis Former Soviet Union

O. arenaria ssp. sibirica 1338 Onobrychis Mongolia

O. biebersteinii 1340 Onobrychis Iran

O. biebersteinii 1342 Onobrychis Former Soviet Union

O. biebersteinii 1345 Onobrychis Russia

O. bungei 1324 Onobrychis Armenia

O. cyri 1348 Onobrychis Former Soviet Union

O. cyri 1349 Onobrychis Russia

O. cyri 1350 Onobrychis Russia

O. iberica 1353 Onobrychis Former Soviet Union

O. iberica 1354 Onobrychis Former Soviet Union

O. iberica 1355 Onobrychis Former Soviet Union

O. inermis 1307 Onobrychis Russia

O. montana 1306 Onobrychis France

O. takhtajanii 1323 Onobrychis Armenia

O. transcaucasica 1300 Onobrychis Armenia

O. transcaucasica 1326 Onobrychis Armenia

O. viciifolia 1007 Onobrychis China

O. viciifolia 1019 Onobrychis Poland

O. viciifolia 1103 Onobrychis Turkey

O. viciifolia 1127 Onobrychis USA

O. viciifolia 1197 Onobrychis Norway

O. viciifolia 1213 Onobrychis Switzerland

O. viciifolia 1220 Onobrychis Morocco

O. viciifolia 1230 Onobrychis Czech Republic

O. viciifolia 1236 Onobrychis Turkey

O. viciifolia 1237 Onobrychis Turkey

O. viciifolia 1243 Onobrychis Romania

O. viciifolia 1257 Onobrychis Turkey

O. viciifolia 1260 Onobrychis China

O. viciifolia 1261 Onobrychis Armenia
OTU 3

O. viciifolia 1126 Onobrychis Greece
OTU 4

O. viciifolia 1163 Onobrychis United Kingdom

O. viciifolia 1256 Onobrychis Turkey

O. arenaria ssp. sibirica 1337 Onobrychis Russia

O. biebersteinii 1341 Onobrychis Hungary
OTU 5

O. viciifolia 1179 Onobrychis Spain

O. argentea 1357 Onobrychis Spain
OTU 6

O. viciifolia 1208 Onobrychis Former Soviet Union

O. petraea 1299 Onobrychis Armenia
OTU 7

Lotus corniculatus 1293
OTU 8

O. subacaulis 1301 Heliobrychis Armenia

O. buhseana 1360 Heliobrychis Armenia
OTU 9

O. michauxii 1302 Hymenobrychis Armenia

O. bobrovii 1315 Hymenobrychis Russia

O. pallasii 1321 Hymenobrychis Former Soviet Union
OTU 10

O. radiata 1305 Hymenobrychis Georgia

O. radiata 1320 Hymenobrychis Armenia

O. radiata 1327 Hymenobrychis Armenia

O. meschetica 1358 Hymenobrychis Armenia
OTU 11

O. pulchella 1311 Lophobrychis Turkmenistan

O. alba ssp. laconica 1328 Lophobrychis Former Soviet Union
OTU 12

O. aequidentata 1316 Lophobrychis France

O. cyri 1347 Onobrychis Former Soviet Union
OTU 13

O. crista-galli 1317 Lophobrychis Unknown
OTU 14

O. iberica 1352 Onobrychis Pakistan
Chloroplast sequences

OTU 1


O. alba ssp. laconica 1330 Lophobrychis Bulgaria

O. altissima 1313 Onobrychis Georgia

O. altissima 1322 Onobrychis Armenia

O. antasiatica 1264 Onobrychis Armenia

O. arenaria 1312 Onobrychis Kazakhstan

O. arenaria 1318 Onobrychis Former Soviet Union

O. arenaria 1308 Onobrychis Germany

O. arenaria ssp. sibirica 1336 Onobrychis Russia

O. arenaria ssp. sibirica 1339 Onobrychis Mongolia

O. arenaria ssp. sibirica 1333 Onobrychis Former Soviet Union

O. arenaria ssp. sibirica 1338 Onobrychis Mongolia

O. arenaria ssp. sibirica 1337 Onobrychis Russia

O. argentea 1357 Onobrychis Spain

O. biebersteinii 1343 Onobrychis Former Soviet Union

O. biebersteinii 1342 Onobrychis Former Soviet Union

O. biebersteinii 1345 Onobrychis Russia

O. biebersteinii 1341 Onobrychis Hungary

O. bungei 1324 Onobrychis Armenia

O. cyri 1346 Onobrychis Former Soviet Union

O. cyri 1348 Onobrychis Former Soviet Union

O. cyri 1349 Onobrychis Russia

O. gracilis 1351 Onobrychis Bulgaria

O. iberica 1353 Onobrychis Former Soviet Union

O. iberica 1354 Onobrychis Former Soviet Union

O. iberica 1355 Onobrychis Former Soviet Union

O. inermis 1307 Onobrychis Russia

O. montana 1310 Onobrychis France

O. pyrenaica 1356 Onobrychis Spain

O. transcaucasica 1300 Onobrychis Armenia

O. transcaucasica 1326 Onobrychis Armenia

O. viciifolia 1001 Onobrychis United Kingdom

O. viciifolia 1012 Onobrychis Italy

O. viciifolia 1017 Onobrychis Spain

O. viciifolia 1028 Onobrychis France

O. viciifolia 1071 Onobrychis United Kingdom

O. viciifolia 1077 Onobrychis Canada

O. viciifolia 1200 Onobrychis Germany

O. viciifolia 1240 Onobrychis Zimbabwe

O. viciifolia 1246 Onobrychis Kazakhstn

O. viciifolia 1262 Onobrychis United Kingdom

O. viciifolia 1007 Onobrychis China

O. viciifolia 1103 Onobrychis Turkey

O. viciifolia 1127 Onobrychis USA

O. viciifolia 1197 Onobrychis Norway

O. viciifolia 1213 Onobrychis Switzerland

O. viciifolia 1220 Onobrychis Morocco

O. viciifolia 1230 Onobrychis Czech Republic

O. viciifolia 1236 Onobrychis Turkey

O. viciifolia 1237 Onobrychis Turkey

O. viciifolia 1257 Onobrychis Turkey

O. viciifolia 1260 Onobrychis China

O. viciifolia 1261 Onobrychis Armenia

O. viciifolia 1126 Onobrychis Greece

O. viciifolia 1163 Onobrychis United Kingdom

O. viciifolia 1256 Onobrychis Turkey

O. viciifolia 1179 Onobrychis Spain
OTU 2

O. cyri 1325 Onobrychis Armenia

O. altissima 1309 Onobrychis Iran

O. antasiatica 1263 Onobrychis Armenia

O. antasiatica 1265 Onobrychis Armenia

O. biebersteinii 1340 Onobrychis Iran

O. montana 1306 Onobrychis France

O. takhtajanii 1323 Onobrychis Armenia

O. viciifolia 1019 Onobrychis Poland
OTU 3

O. viciifolia 1208 Onobrychis Former Soviet Union

O. petraea 1299 Onobrychis Armenia
OTU 4

O. viciifolia 1243 Onobrychis Romania

O. alba ssp. laconica 1332 Lophobrychis Bulgaria

O. cyri 1350 Onobrychis Russia
OTU 5

Lotus corniculatus 1293 New Zealand
OTU 6

O. subacaulis 1301 Heliobrychis Armenia

O. buhseana 1360 Heliobrychis Armenia
OTU 7

O. michauxii 1302 Hymenobrychis Armenia

O. bobrovii 1315 Hymenobrychis Russia

O. pallasii 1321 Hymenobrychis Former Soviet Union

O. radiata 1305 Hymenobrychis Georgia

O. radiata 1320 Hymenobrychis Armenia

O. radiata 1327 Hymenobrychis Armenia

O. meschetica 1358 Hymenobrychis Armenia
OTU 8

O. pulchella 1311 Lophobrychis Turkmenistan

O. alba ssp. laconica 1328 Lophobrychis Former Soviet Union
OTU 9

O. aequidentata 1316 Lophobrychis France

O. cyri 1347 Onobrychis Former Soviet Union
OTU 10

O. crista-galli 1317 Lophobrychis Unknown
OTU11

O. iberica 1352 Onobrychis Pakistan
Combined dataset

OTU 1


O. viciifolia 1001 Onobrychis United Kingdom

O. viciifolia 1012 Onobrychis Italy

O. viciifolia 1017 Onobrychis Spain

O. viciifolia 1028 Onobrychis France

O. viciifolia 1071 Onobrychis United Kingdom

O. viciifolia 1077 Onobrychis Canada

O. viciifolia 1200 Onobrychis Germany

O. viciifolia 1240 Onobrychis Zimbabwe

O. viciifolia 1246 Onobrychis Kazakhstan

O. viciifolia 1262 Onobrychis United Kingdom

O. montana 1310 Onobrychis France

O. arenaria 1312 Onobrychis Kazakhstan

O. arenaria 1318 Onobrychis Former Soviet Union

O. arenaria ssp. sibirica 1336 Onobrychis Russia

O. arenaria ssp. sibirica 1339 Onobrychis Mongolia

O. biebersteinii 1343 Onobrychis Former Soviet Union

O. gracilis 1351 Onobrychis Bulgaria

O. pyrenaica 1356 Onobrychis Spain
OTU 2

O. viciifolia 1007 Onobrychis China

O. viciifolia 1103 Onobrychis Turkey

O. viciifolia 1127 Onobrychis USA

O. viciifolia 1197 Onobrychis Norway

O. viciifolia 1213 Onobrychis Switzerland

O. viciifolia 1220 Onobrychis Morocco

O. viciifolia 1230 Onobrychis Czech Republic

O. viciifolia 1236 Onobrychis Turkey

O. viciifolia 1237 Onobrychis Turkey

O. viciifolia 1260 Onobrychis China

O. viciifolia 1261 Onobrychis Armenia

O. antasiatica 1264 Onobrychis Armenia

O. transcaucasica 1300 Onobrychis Armenia

O. inermis 1307 Onobrychis Russia

O. arenaria 1308 Onobrychis Germany

O. altissima 1313 Onobrychis Georgia

O. altissima 1322 Onobrychis Armenia

O. transcaucasica 1326 Onobrychis Armenia

O. alba ssp. laconica 1330 Lophobrychis Bulgaria

O. arenaria ssp. sibirica 1333 Onobrychis Former Soviet Union

O. arenaria ssp. sibirica 1338 Onobrychis Mongolia

O. biebersteinii 1342 Onobrychis Former Soviet Union

O. biebersteinii 1345 Onobrychis Russia

O. cyri 1348 Onobrychis Former Soviet Union

O. cyri 1349 Onobrychis Russia

O. iberica 1353 Onobrychis Former Soviet Union

O. iberica 1354 Onobrychis Former Soviet Union

O. iberica 1355 Onobrychis Former Soviet Union

O. viciifolia 1243 Onobrychis Romania

O. alba ssp. laconica 1332 Lophobrychis Bulgaria
OTU 3

O. viciifolia 1019 Onobrychis Poland

O. antasiatica 1263 Onobrychis Armenia

O. antasiatica 1265 Onobrychis Armenia

O. montana 1306 Onobrychis France

O. altissima 1309 Onobrychis Iran

O. takhtajanii 1323 Onobrychis Armenia

O. biebersteinii 1340 Onobrychis Iran
OTU 4

O. viciifolia 1126 Onobrychis Greece
OTU 5

O. viciifolia 1163 Onobrychis United Kingdom

O. arenaria ssp. sibirica 1337 Onobrychis Russia

O. biebersteinii 1341 Onobrychis Hungary
OTU 6

O. viciifolia 1179 Onobrychis Spain

O. argentea 1357 Onobrychis Spain
OTU 7

O. viciifolia 1208 Onobrychis Former Soviet Union

O. petraea 1299 Onobrychis Armenia
OTU 8

O. viciifolia 1256 Onobrychis Turkey
OTU 9

O. viciifolia 1257 Onobrychis Turkey

O. bungei 1324 Onobrychis Armenia
OTU 10

Lotus corniculatus 1293 New Zealand
OTU 11

O. subacaulis 1301 Heliobrychis Armenia
OTU 12

O. michauxii 1302 Hymenobrychis Armenia

O. bobrovii 1315 Hymenobrychis Russia

O. pallasii 1321 Hymenobrychis Former Soviet Union
OTU 13

O. radiata 1305 Hymenobrychis Georgia

O. radiata 1320 Hymenobrychis Armenia

O. radiata 1327 Hymenobrychis Armenia

O. meschetica 1358 Hymenobrychis Armenia
OTU 14

O. pulchella 1311 Lophobrychis Turkmenistan

O. alba ssp. laconica 1328 Lophobrychis Former Soviet Unio
OTU 15

O. aequidentata 1316 Lophobrychis France

O. cyri 1347 Onobrychis Former Soviet Union
OTU 16

O. crista-galli 1317 Lophobrychis Unknown
OTU 17

O. cyri 1346 Onobrychis Former Soviet Union

O. cyri 1325 Onobrychis Armenia
OTU 18

O. cyri 1350 Onobrychis Russia
OTU 19

O. iberica 1352 Onobrychis Pakistan
OTU 20

O. buhseana 1360 Heliobrychis Armenia






База данных защищена авторским правом ©shkola.of.by 2016
звярнуцца да адміністрацыі

    Галоўная старонка