Electronic supplemental materials




Дата канвертавання19.04.2016
Памер61.23 Kb.
Electronic supplemental materials to

Molecular phylogeny of tribe Forsythieae (Oleaceae) based on nuclear ribosomal DNA internal transcribed spacers and plastid DNA trnL-F and matK gene sequences

Table S1 Vouchers and GenBank accession numbers for the sequenced taxa.

Taxa

Source of DNA/Voucher

GenBank accession number

ITS

trnL-F

matK

Oleaceae

Tribe Forsythieae

Abeliophyllum distichum Nakai

Abeliophyllum distichum for. lilacinum Nakai

Abeliophyllum distichum for. eburneum T. Lee

Forsythia koreana Nakai

Forsythia saxatilis Nakai

Forsythia ovata Nakai

Forsythia nakaii T.Lee

Forsythia japonica Makino

Forsythia viridissima Lindley

Forsythia suspensa Vahl

Forsythia intermedia Zabel

Forsythia giraldiana Ling

Forsythia europaea Degen & Bald.

Tribe Fontanesieae

Fontanesia fortunei Carriere

Fontanesia phillyreoides Labill.

Tribe Jasmineae

Jasminum nudiflorum Lindley

Jasminum humile L.

Tribe Oleeae

Chionanthus retusus Lindl. & Paxton

Fraxinus rhynchophylla Hance

Ligustrum obtusifolium Siebold & Zucc.

Osmanthus heterophyllus (G.Don) P.S.Green

Syringa oblata var. dilatata (Nakai) Rehder

Gesneriaceae

Streptocarpus caulescens Vatke

Scrophulariaceae

Myoporum insulare R.Br

Myoporum montanum R.Br

Verbenaceae

Verbena rigida Spreng.

Bignoniaceae

Campsis radicans (L.) Seem. ex Bureau

Paulowniaceae

Paulownia tomentosa (Thunb.) Steud.

Acanthaceae

Avicennia marina (Forssk.) Vierh.

Kim & Jeon 0044, Korea

Kim & Jeon 0027, Korea

Kim & Jeon 0010, Korea

Kim & Jeon 0144, Korea

Kim & Jeon 0048, Korea

Kim & Jeon 0100, Korea

Kim & Jeon 0154, Korea

M. Togashi 130, Japan

Kim & Jeon 0033, Korea

RBGKew 264-79, 06640

RBGKew 000-73, 21134

RBGKew 1995-1652, 1137

RBGKew 367-32, 36906


Kim s. n., Korea

Kim & Jeon 0156, Korea


Kim & Jeon 0018, Korea

RBGKew s. n.


Kim s. n., Korea

Kim s. n., Korea

Kim s. n., Korea

Kim s. n., Korea

Kim s. n., Korea
-
-

-
-
-


-

AF534803


AF534804

AF534805


AF534806

AF534807


AF534812

AF534811


AF534813

AF534810


AF534808

AF540073


AF534809

AF534814
AF534815

AF534816
AF534817

AF534818
HM751201

HM751202

HM751203


HM751204

HM751205
AF316920


EU886845

FJ867403
DQ515201


AF478941
AF477771

EU281150


EU281151

EU281152


EU281153

EU281154


EU281155

EU281156


EU281144

EU281145


EU281157

EU281158


EU281159

EU281160
EU281148

EU281149
EU281146

EU281147
EU281165

EU281162

EU281161


EU281164

EU281163
AJ430918

AJ430934
AJ430940
FJ870022
AJ430926
AJ430913


EU281166


EU281168

EU281167


EU281169

EU281170


EU281171

EU281172


EU281173

EU281174


EU281175

EU281176


EU281177

EU281178
EU281179

EU281180
EU281181

EU281182
HM751206

HM751207

HM751208


HM751209

HM7512010


AJ429331

AF531808
AJ429353


AF531775
AF051997
AB114527

Table S2 Primer sequences used for PCR and sequencing.



Name

Primer sequence (5′→3′)

Position

Reference

ITS5

ITS4


trn1c

trn2d


trn5e

trn6f


3914F

–19F


1412F

900R


1470R

2R


GGAAGTAAAAGTCGTAACAAGG

TCCTCCGCTTATTGATATGC

CGAAATCGGTAGACGCTACG

GGGGATAGAGGGACTTGAAC

GGTTCAAGTCCCTCTATCCC

ATTTGAACTGGTGACACGAG

GGGGTTGCTAACTCAACGG

CGTTCTGACCATATTGCACTATG

ATATAATTCTTATGTATGTG

GAAGCCAGAATTGCTTTTCCT

AAGATGTTGATYGTAAATGA

AACTAGTCGGATGGAGTAG



ITS fwd

ITS rev

trnL fwd

trnL rev

trnL-F igs fwd

trnL-F igs rev

5′-trnK intron fwd

5′-trnK intron fwd

matK internal fwd

matK internal rev

matK internal rev

3′-trnK intron rev



White et al. (1990)

White et al. (1990)

Taberlet et al. (1991)

Taberlet et al. (1991)

Taberlet et al. (1991)

Taberlet et al. (1991)

Johnson & Soltis (1995)

Gravendeel et al. (2001)

Johnson & Soltis (1995)

Johnson & Soltis (1995)

Johnson & Soltis (1995)

Steele & Vilgalys (1994)


Table S3 Summary descriptions and parsimony analysis results for sequences included in individual and combined analyses of nuclear ribosomal region (ITS) and two plastid regions (trnL-F and matK).



Characters

ITS (I)

trnL-F (II)

matK (III)

Plastid

(II + III)



Combined

(I + II + III)



Length of sequence region (bp)

Abeliophyllum

Forsythia

Fontanesia

Jasminum

Aligned length

Parsimony informative sites

Variable sites

Constant sites

G + C (%)



Abeliophyllum

Forsythia

Fontanesia

Jasminum

Sequence divergence



Abeliophyllum

Forsythia

Fontanesia

Jasminum

Abeliophyllum vs Forsythia

Abeliophyllum vs Fontanesia

Fontanesia vs Jasminum

623


624–626

623


607-620

721


248

354


367
55.2

55.2


60.8

60.8
0.004-0.008

0.004-0.069

0.018


0.015

0.08-0.11

0.156-0.17

0.008-0.021


890


890–892

890–893


886-912

1006


93

272


734
35.4

35.4


34.9

34.8
0.001-0.002

0.001

0.005


0.038

0.001-0.004

0.018-0.021

0.045-0.06


1518


1519–1522

1524–1525

1524

1540


163

426


1114
38.3

38.3


39.7

33.2
0

0.001-0.01

0.005


0.007

0.002-0.007

0.017-0.022

0.021-0.026


2408


2409-2414

2414-2418

2410-2436

2546


256

698


1848
33.8

33.9


34.2

33.8
0-0.001

0.001-0.007

0.005


0.019

0.002-0.006

0.017-0.022

0.03-0.038


3031


3033–3037

3038–3040

3030-3043

3267


504

1052


2215
38.2

38.3


39.7

39.3
0.001-0.002

0.001-0.017

0.006


0.018

0.018-0.025

0.043-0.049

0.026-0.034




База данных защищена авторским правом ©shkola.of.by 2016
звярнуцца да адміністрацыі

    Галоўная старонка