Characteristics of the 147 foxtail millet micrisatellite markers developed in the present study



старонка1/3
Дата26.04.2016
Памер1.24 Mb.
#36250
  1   2   3
ESM1: Characteristics of the 147 foxtail millet micrisatellite markers developed in the present study.




Sl. No

Marker

GenBank

Accession

Repeat

Motif

Primer sequences (5'-3')+

Tm (0C)

Polymo-

rphism*

Allele size (bp)

E-Value

BLASTN annotation




1

MPGA01

BV729566

(GT)15

F: GAGAGGATAGGTGAGGAAGAAAAC

R: ATCAGATCAGAGATGTTCTTTCCC



55

M

242

1e-09

Mus musculus chromosome 3, clone RP23-113O9




2

MPGA02

BV729477

(CA)12

F: GGTAGACAAGTCATTACACCCATG

R: CAATGTTGATAATTGTCCATGCCC



55

M

294

1e-26

Zea mays PCO097710 mRNA sequence




3

MPGA03

BV729576

(CA)15

F: GTCACTTTACCAGCTTCCTACCAT

R: TCTCGATCTGAAACCATGCATGC



50

M

427

3e-10

Mus musculus BAC clone RP23-239E2




4

MPGA04

BV729567

(CA)17

F: ATGCAACGAAAGGTCTCAAACTAC

R: TGTGTGTTTCCCTTTGCCAATGATA



55

P

190

6e-34

Oryza sativa PAC clone:P0516G10




5

MPGA05

BV729478

(GT)12

F: CACGAGAACATGGAAACAATTAGC

R: TATTGTCCCCCTACGTTCCTTGAG



55

P

154

5e-05

Oryza sativa PAC clone: P0045F02




6

MPGA07

BV729479

(GT)11

F: CATGTTAATCTCTGCCCTTGATCC

R: CTACTTGATTGCAATGTTTTGGGC



50

M

244

8e-12

Oryza sativa microsatellite MRG6365 containing (CTAT)X11




7

MPGA08

BV729480

(GT)4 T (GT)12

F: CATTTGGGGATTGGGAGTAGTTGG

R: ACTCTGATGATTCTGCTGTCACCC



50

P

124

9e-24

Oryza sativa Japonica Group genomic DNA




8

MPGA09

BV729481

(CA)10

F: GAGTTCAAATATAGTTAGGCTCCC

R: AGGAGCATGTTTTCAGCCAAGGTT



55

M

408

7e-13

Panicum virgatum clone PV_ABa006-H10




9

MPGA10

BV729569

(CA)14

F: GGACCTCTATACACATCCAGAAAG

R: ATCGATCGATCCCCACAAACTTGA



55

P

393

6e-09

Oryza sativa BAC clone:OJ1449_C01




10

MPGA11

BV729482

(CA)10

F: AACGGTGAGCAACATGTACAAAAC

R: CAGGCTTAGGGTGAAAGAAAGGAA



55

P

334

1e-27

Zea mays hypothetical protein




11

MPGA12

BV729577

(CA)12

F: ACTTGCCAAGGAACCACCCAAAGC

R: GCTAGGCATTGTGCTCACGTAAAG



55

P

257

5e-10

Oryza sativa BAC clone: OSJNBb0050N09




12

MPGA13

BV729483

(CA)15

F: CCCATCCTTTCTCCAAATGTTGTC

R: AGATCCTATCGGTGTTTCGTAACG



55

P

336

1e-15

Dicentrarchus labrax chromosome sequence




13

MPGA14

BV729578

(GT)11

F: CAAGGATTTCTGAAGGGTGAGCAC

R: TTATTATAAGCCCACCCTACCACG



55

P

340

3e-04

Oryza punctata clone OP__Ba0041E06




14

MPGA17

BV729486

(CA)11

F: TAGCCGGACTCACCTGAATTTC

R: GCCAGTCTTAGCTAAGGTGGGT



50

P

240

9e-67

Panicum virgatum clone PV_ABa103-K10




15

MPGA19

BV729488

(GT)13

F: CTCTAAATACGACTCGCTCTGTTT

R: TCTTACTCCTTTTCCATGGGCTCC



55

P

427

6e-54

Panicum virgatum clone PV_ABa103-K10




16

MPGA21

BV729570

(GT)8 GC (GT)7

F: CTGAAAACTGGACTAGAAGAAGCA

R: CATCAATGGGTGGAGCATTTAGCA



55

P

289

1e-08

Mus musculus BAC clone RP24-500I10




17

MPGA22

BV729489

(CT)13(CA)10

F: TGGTTCCAAAGGAAGGCAGAATAG

R: ACACAGGAAACAGCTAGACCATG



50

M

255

8e-18

Mus musculus BAC clone RP24-160E3




18

MPGA23

BV729490

(GT)13

F: CGGCAAGTTCAATCTCACCTTTG

R: GCTTATCTCCCAACCCTGCTCAAC



50

M

417

3e-42

Panicum virgatum clone PV_ABa006-H10


























































































































































































































































































































































































































































































































































































































19

MPGA24

BV729579

(CT)17 (GT)12

F: TTCATCACATGCAAATGCTGGAGC

R: GAACACGCTATGACCATGATTACG



50

M

192

1e-09

Vitis vinifera, whole genome shotgun sequence

20

MPGA25

BV729571

(GT)19

F: GTTGGATAGCCACCCCTTGATTGT

R: CACAGGAAACAGCTATGACCATGA



55

P

252

6e-44

Panicum virgatum clone PV_ABa011-H10

21

MPGA26

BV729580

(CA)11

F: GCTTTTATCGCTATCGGACTCC

R: TTCTGCTACGGTACCCTACTTGTG



55

M

224

2e-69

Panicum virgatum clone PV_ABa020-D10

22

MPGA27

BV729491

(CA)17

F: CCTCCACCATTCCCCTTGACAATA

R: CAGCGAGCTGAAATCTTATGCATG



55

P

380

5e-14

Vitis vinifera contig VV78X061571.3

23

MPGA29

BV729572

(CA)6 CG (CA)8

F: ATTGGTCCACAAGTTTAGTCGTCG

R: GGAACGGAGGGAGTATAATGTTTG



55

M

376

6e-13

Zea mays superoxide dismutase 4 (sod4) gene

24

MPGA30

BV729493

(CA)14N18(CA)6

F: ATTTGGTGCATTCCCTTCCCTCTG

R: AGTTGGAGAAGTTGAGTGCAAGGATTT



55

P

366

2e-12

Mus musculus chromosome 15, clone RP24-298F20

25

MPGA31

BV729581

(CA)26

F: ACTCATCCGTTGCGTTTCTTCCTC

R: CGAAAAAGTTTTTGCCTATGCCTGC



55

P

345

8e-18

Mouse DNA sequence from clone RP23-105H6

26

MPGA33

BV729582

(GT)12

F: GTTGATAATTGTCCATGCCCCAGG

R: GTTGATAATTGTCCATGCCCCAGG



50

M

376

2e-06

Mus musculus chromosome 1, clone RP24-75E15

27

MPGA36

BV729496

(GT)22

F: GTGAAATAATGCTGCCCGAGGAAG

R: TGGGAACAGTGTGAGCTCGAAGTA



50

M

274

3e-49

Zea mays lipoxygenase (LOX5), mRNA

28

MPGA38

BV729497

(GT)11

F: GGCTTTGTTAGGATCTGTACCGTC

R: TTCACACAGGAAACAGCTATGACC



55

P

213

9e-67

Panicum virgatum clone PV_ABa003-D10

29

MPGA39

BV729575

(GT)13

F: CAAAACGTGTCCTTGTACTCAGCC

R: GCTCGTGTGCAGAGTTTGAACTTG



55

P

350

5e-08

Mus musculus chromosome 8, clone RP23-168D5

30

MPGA40

BV729498

(GT)9

F: GAGGACAAACCAAGGGAGGGAT

R: GCACCAGTCGGCAAGAGATGAAAT



55

M

442

2e-31

Sorghum bicolor hypothetical protein

31

MPGA41

BV729499

(GT)19

F: ACTATACCTTGTTTTGTGCCGCCG

R: AGGGGCAGTTATGGATTTTGATCG



55

P

359

6e-13

Mus musculus BAC clone RP23-90B4

32

MPGA42

BV729500

(GT)18

F: TCTTTTATGCGCGTAAGGCTTCGG

R: CTTTTACTTCTCCTCACATCGGGC



55

P

337

2e-13

Saccharum hybrid cultivar R570 microsatellite DNA

33

MPGA43

BV729583

(CA)23

F: GTCTGTGTCATTTCTTTTGCGTC

R: CCTATATGCATTGCAGAGTGGGC



55

P

373

3e-17

Mus musculus chromosome 7, clone RP24-362L9

34

MPGA44

BV729501

(GT)10

F: GGCAACGGCTTAGCATAAATCCCA

R: TTTAGCAACCGAACAAGGAGTGGG



55

M

497

2e-98

Panicum virgatum clone PV_ABa006-H10

35

MPGA45

BV729502

(CA)12

F: TCAGAAAGGAGATGAGGGTAGTGG

R: CTGTCGATAATTTGTGTCCAGAGG



55

P

308

1e-08

Oryza sativa Japonica Group genomic DNA

36

MPGA46

BV729584

(GT)12

F: CTGCAGAGTTAAAACCTATCCGGG

R: GACGGGGATACAAGCAAGTATGTG



55

P

358

3e-46

Panicum virgatum clone PV_ABa006-H10

37

MPGA47

BV729503

(GT)11

F: ACCCTGTGTTGGACATCTTGCAGA

R: TGATGCCACCAGTTTTACTAGCAG



55

M

289

3e-61

Sorghum bicolor hypothetical protein, mRNA

38

MPGA48

BV729585

(CT)4 CC (CT)2(CA)15

F: CTTTGGTTCGGGCTGAATAGATGC

R: ACCCTACCACGAATAGAACTGACC



50

M

443

6e-07

Populus nigra microsatellite DNA


39

MPGA50

BV729505

(CA)13

F: CAAACCCGAGAGAAAGTCG

R: TGGAAAGCCAGTGTGAGTG



55

M

289

6e-09

Oryza sativa BAC clone: OJ1449_C01

40

MPGA51

BV729506

(CA)14

F: CACCCGTCTATGCTATCAGT

R: ATGAGATTGCCCAAGAGTAGT



55

P

176

5e-35

Zea mays full-length cDNA clone ZM_BFc0042J13

41

MPGA52

BV729507

(CA)9

F: AACTGCCGGACTCTTCTG

R: ACGAATTACGGCTTGGTC



55

P

101

9e-19

Panicum virgatum clone PV_ABa020-D10

42

MPGA53

BV729508

(GT)9

F: TTGGGATGACACACAAGAAG

R: GACCTATGGAAAACCCTTATC



55

P

248

8e-07

Oryza sativa BAC clone OSJNBa0064H09

43

MPGA54

BV729509

(GT)9 CCTA (GT)10

F: GCGTGTGTGTAAAGCACGTAC

R: GGACACCTGAAAGACGAACAC



55

P

240

-


No homology

44

MPGA55

BV729510

(GT)12

F: AAAGGCAGTAACAGTTCATACC

R: AACCTGGACACAAAGGATG



55

P

277

2e-28

Oryza australiensis clone OA_CBa0164J23

45

MPGA56

BV729511

(GT)13

F: GGCCACATAACTAGCACTTGG

R: TCAGTGGGGTTGATCCTACAC



55

P

172

5e-79

Panicum virgatum clone PV_ABa011-H10

46

MPGA57

BV729512

(CA)13

F: TTCGTTTGAATCCAATGTGTC

R: TCACGCTTGGTTAGTTAGCTG



55

P

148

1e-08


Mus musculus BAC clone RP24-349H1

47

MPGA58

BV729513

(GT)13

F: ACGGTTTGGTCACATAACTAGC

R: ATCCAAGTTTTATCGCTATTGG



55

M

140

3e-88


Panicum virgatum clone PV_ABa051-H10

48

MPGA59

BV729514

(GT)9 GC (GT)18

F: CTCCTCAATGCACACCTCTATG

R: GTGCTGCACTACCTAACCAGTG



55

P

221

1e-16


Mus musculus BAC clone RP24-349H1

49

MPGA60

BV729515

(CA)11

F: AACTGCCGGACTCTTTCTG

R: GACGAATTACGGCTTGGTC



55

P

103

4e-30

Panicum virgatum clone PV_ABa051-H05

50

MPGA61

BV729516

(TC)15 ACG (CA)21

F: AGCAGGTCATAGAAACAACG

R: AGAGGGTGATAAGCGGTAAC



55-

P

299

-

No homology

51

MPGD01

BV729517

(ATG)5

F: GACTATTCACGCCCACATATACAA

R: ATCCTGACCTAGATCATCGAGAGA



55

P

243

3e-12

Triticum aestivum 3B-specific BAC

52

MPGD02

BV729518

(ATC)14

F: TTGTACCTGCTATGCTCAAATACC

R: GGTTAGCATGCATATGTAACATCC



55

P

221

3e-18

Medicago truncatula clone mth2-62m1

53

MPGD03

BV729519

(ATG)5

F: GCTCTAGCTAGCCTACTGTGGTTT

R: ATTTCCACTACCACCATCATCAC



55

P

242

-

No homology

54

MPGD04

BV729520

(ATG)9

F: TACTACACACCATTTCCGTCCATA

R: ACATGATATACTCCCTCCTCCATC



55

P

223

-

No homology

55

MPGD05

BV729521

(ATG)7

F: GAGCGAAAACTATCAGGTAACAGG

R: TTGCTAGGTAGCACAAGTTATTGC



55

M

207

2e-34

Setaria italica GBSS1 gene

56

MPGD06

BV729522

(ATG)4

F: CAGCAAGTAGCTTGTGAATTATGG

R: TGTCCCAGTGCATTCCTATTTAC



55

M

242

7e-20

Oryza sativa Os04g0243400 mRNA

57

MPGD07

BV729523

(ATG)4

F: CAACCTAGGCCCAGTATTAGTGAC

R: CACCAATGTTAGTCACCATGTCAG



55

M

178

5e-22

Panicum virgatum clone PV_ABa051-H10

58

MPGD09

BV729525

(ATC)5

F: GTCGTTCTCTTATTCATCTCCACA

R: CCATCTAAAGCAAACCTAGCTCAT



55

M

230

4e-04

Sorghum bicolor hypothetical protein

59

MPGD10

BV729526

(ATC)9

F: CATCTGTTGCTGCTGATGCT

R: AATTCTCAAAAGAGAGACCCACTG



55

M

185

3e-06

Tetraodon nigroviridis

60

MPGD12

BV729528

(ATC)11

F: CAAGTTCAGAAACATTACCACCTG

R: GTAAGAAAAGGTCTGCTTGGGATA



55

M

180

8e-120

Zea mays BAC clone CH201-9J2

61

MPGD13

BV729529

(TCA)9

F: ATGTCAGCATGAGTAACATTCTCG

R: TTGGTGATGGATTCGTCATTAG



55

M

184

2e-20

Oryza australiensis clone a0096N06

62

MPGD15

BV729531

(ATG)7

F: CGTCCAACTCATGGATAGGTAAAT

R: CTGACAAGGAAGAATTGGAAGTGT



55

P

222

1e-15

Oryza ridleyi clone

63

MPGD16

BV729532

(ATG)5

F: TGGGGAGAAAGACAATAAGGAT

R: TCTGACACAAGATCACCAAATACAC



55

P

231

6e-26

Homo sapiens BAC clone RP11-793L24

64

MPGD17

BV729533

(ATG)6

F: AGAACAAGAAGAAACAAAGAGGTG

R: CTGGAGTGAGTCTTCGTCATCAT



55

P

243

2e-121

Zea mays contig56950, mRNA sequence

65

MPGD18

BV729534

(ATG)16

F: GTGTGGTAGTTGGGAGCTTAGAAT

R: CTATAGCAGCACACATGGCTTATC



55

P

249

1e-09

Solanum lycopersicum DNA,

66

MPGD19

BV729535

(ATC)5

F: GTCTACACTTGTTCCTGCCAAAA

R: GAGTGCACTATGCAGCTACGTT



55

M

154

7e-57

Zea mays AGP16 (LOC100282009), mRNA

67

MPGD20

BV729536

(ATG)6

F: GAGATGAGGTTGCTGCTGGT

R: CACCAAATCTACCCTTTCCTCTTT



55

P

179

6e-07

unknown protein (AT5G37430) mRNA

68

MPGD21

BV729537

(TCA)6

F: GCTCTTTCACCATCAACCATTC

R: AGTAGAGGATGCGAAACCACTTT



55

M

225

8e-12

Zea mays clone 345379 mRNA sequence

69

MPGD22

BV729538

(ATG)9

F: GAAGCTGCCTACCAAACTGTATCT

R: TTTAAGAGGTGAGGAACGACCTAC



55

P

216

3e-36

Sorghum bicolor hypothetical protein, mRNA

70

MPGD23

BV729539

(ATG)5

F: TGAATGCTCTAGTGATAGTGAAGG

R: CTGAATTCAACAGGATCTGAGACA



55

M

219

8e-69

Sorghum bicolor hypothetical protein, mRNA

71

MPGD24

BV729540

(TCA)5

F: AGTTAGCTGAATAACCCGAACCTT

R: CGCTGAGGACTACACCAAGTT



55

P

181

2e-127

Sorghum bicolor hypothetical protein, mRNA

72

MPGD25

BV729541

(ATG)5

F: CTAATGGTGAAGGAGGGAGTGAT

R: ACAACACAACTAGCAGCATGAAAC



55

M

208

2e-95

Zea mays zinc finger protein hangover (LOC100286121)

73

MPGD26

BV729542

(TCA)9(TC)10

F: TGTTGTGGCTACCAAGCTATATTC

R: AGGGAACAACAGTCACAATTAAGG



55

P

157

-

No homology

74

MPGD27

BV729543

(ATG)7

F: GATGATGTGAGTGTTGGGAGAA

R: CCTTTCCTCTTTATAGTCGTCACC



55

P

245

4e-29

Homo sapiens BAC clone RP11-571N1

75

MPGD28

BV729544

(TCA)6

F: CTGAGTCATCGACAGTTAGCACTT

R: GAGATGAGGTTGCTGCTGGT



55

M

249

-

No homology

76

MPGD29

BV729545

(ATC)7

F: AGCTGGCTCTTCTTTGTCTAACTC

R: ACGATGAGGATGACGATGTAGTT



55

M

248

3e-43

Sorghum bicolor hypothetical protein, mRNA

77

MPGD30

BV729546

(ATG)4

F: TGGGGAGAAAGACAATAAGGATAG

R: CAACGGTTAACACTTTGATGTTGC



55

M

182

3e-23

Homo sapiens BAC clone RP11-793L24

78

MPGD31

BV729547

(ATC)7

F: AGACGTTTAGCATAAGCAGGAAAG

R: ATGCTCTACTTCAGGTTGATCTCC



55

M

234

4e-16

Pennisetum glaucum x Pennisetum squamulatum clone PsCMD3

79

MPGD32

BV729548

(ATG)15

F: CTAGTGGTGCACTACCATCTGAAG

R: GAGGAGGATGTGCTACGTATTTCT



50

P

239

3e-04

Oryza granulata clone OG_ABa0049D11

80

MPGD33

BV729549

(ATC)6

F: ATCCTGACCTAGATCATCGAGAGA

R: GACTATTCACGCCCACATATACAA



55

M

243

1e-47

Oryza minuta clone OM__Ba0187I19

81

MPGD34

BV729550

(ATG)7

F: AATATGGAGGTGTTAGGTTGAGGA

R: AAGGCAGTTGCAGATGTATGTCTA



55

P

172

6e-58

Zea mays transposon TCUP transposase gene

82

MPGD35

BV729551

(ATG)7

F: ATCCAAGTTATGAACCGGAACCT

R: TGCTGGATCATAGTTAAGATCGTC



55

P

235

2e-76

Oryza sativa Japonica Group genomic DNA

83

MPGD36

BV729552

(ATG)14

F: CACATGGTTGTCAGGAGCTCTAT

R: ATCATCATCACCACCACCAC



55

M

222

-

No homology

84

MPGD37

BV729553

(ATG)7

F: CTATCAGACAAATTTGAGCACCAC

R: TCTAGAGCCTAGTGCCAAGC



55

P

225

6e-23

Oryza sativa Japonica Group genomic DNA

85

MPGD38

BV729554

(ATG)6

F: GGGAGCTTTATTGGTAGATGTTGT

R: CGCTTATGTCTAAACACAGCTCAT



55

M

191

-

No homology

86

MPGD39

BV729555

(TCA)8

F: TCAACCATTCGAGCTAGTCAG

R: AGCGTAGAAGAGGAGGATGTG



55

P

230

2e-17

Volvox carteri f. nagariensis

87

MPGD41

BV729557

(ATG)7

F: CATGGAAGCTCAAGTGAATAAG

R: TTGATGATGATGTCCTTCTCTC



55

P

174

8e-117

Pennisetum glaucum BAC 311G2

88

MPGD42

BV729558

(ATG)5

F: ATGCCTAACTATTTCGTTTGG

R: TCATTGACTCCTTCACATTCTC



55

M

236

8e-22

Panicum virgatum clone PV_ABa006-H10

89

MPGD43

BV729559

(ATC)8

F: CTGCCTACCAAACTGTATCTGC

R: ACTCGAAGGTCTTCAGGTAACC



55

P

167

6e-68

Sorghum bicolor hypothetical protein, mRNA

90

MPGD44

BV729560

(ATC)15

F: TCGCACTTCCGAAAATGTT

R: GCAAACCTGAATCGTGAGG



55

P

160

2e-12

Hypothetical protein OsJ_16107 [Oryza sativa Japonica Group]

91

MPGD45

BV729561

(ATC)9

F: ATGGTTCACTGTGTCATAGTCC

R: AAGGTCTGCTTGGGATAAAA



55

P

199

9e-148

Zea mays transposon TCUP transposase gene

92

MPGD46

BV729562

(ATG)7

F: GATGGGTCGTCGTTAGAGTTT

R: GGAAAGGGAAAGGAAGATAGC



55

P

124

1e-44

Panicum virgatum cDNA

93

MPGD47

BV729563

(ATC)6

F: CCCCTCTAGTCAACATCATAGA

R: CTATTCACGCCCACATATACA



55

P

262

1e-12

Triticum aestivum BAC library

94

MPGD48

BV729564

(TCA)6

F: ACCAAATCTACCCTTTCCTCT

R: GTTGGAGATGAGGTTGCTATC



55

P

227

4e-19

Zebrafish DNA sequence

95

MPGD49

BV729565

(TCA)5

F: CAGCGCATGGTAACTACTGC

R: GGAAAATGGTGAGGAAGCTG



55

P

269

2e-149

Zea mays contig56950

96

MPGC01

GF110877

(AAC)3 AA (AAC)5

F: CGAGTGTGGATTGATATTCTTG

R: CAAAGTGCTATACTCACCTCTAGCC



55

M

428

7e-16

Triticum aestivum BAC library

97

MPGC02

GF110878

(AAC)6

F: GTATGTGAGAGAAGGGAGCTTGTT

R: ATCGACTTGGTATATGACTGGACA



55

M

275

-

No homology

98

MPGC03

GF110879

(AAC)3 CCC (AAC)5

F: CACTAGCAATAGTAGGGCATGCTT

R: TGACTAGAAACTCATCGAGTACCA



55

M

294

6e-74


Panicum virgatum clone PV_ABa003-D10

99

MPGC04

GF110880

(TTG)7

F: AAAGATTTAGCCCTGGATAGGAGT

R: GATTGCATCAGTTTGACCTACTTG



55

M

264

5e-56

Zea mays alcohol dehydrogenase 1 (adh1A) gene

100

MPGC05

GF110881

(TTG)7

F: AAAGATTTAGCCCTGGATAGGAGT

R: TGGATAACCCACTGAGAACTACAA



55

M

289

4e-44

Panicum virgatum microsatellite PVSSR008 sequence

101

MPGC06

GF110882

(AAC)9

F: CTCCAATGACCAACACACATTAGT

R: CTCTAGCCTACCCTAACTTGCTTG



55

M

102

7e-48

Zea mays BAC clone

102

MPGC07

GF110883

(TTG)9

F: AAAGATTTAGCCCTGGATAGGAGT

R: ACATGAGCTGGTGTCTGAGAAATA



55

M

198

4e-25

Zea mays BAC clone

103

MPGC08

GF110884

(AAC)7

F: CTACCAGTAAACACAAAAGTGCTCA

R: GATGTGAAGTCGACAGGTATTCAT



55

M

220

4e-57

Zea mays alcohol dehydrogenase 1

104

MPGC09

GF110885

(AAC)8

F: GATTGCATCAGTTTGACCTACTTG

R: AAAGATTTAGCCCTGGATAGGAGT



55

M

264

4e-101

Sorghum bicolor hypothetical protein, mRNA


105

MPGC10

GF110886

(TTG)8

F: CAGGTCTTGGGAGGTAATTTCTTT

R: TAGAGCCTTCTTGACAAGTGAATG



55

M

124

4e-101

Sorghum bicolor hypothetical protein, mRNA

106

MPGC11

GF110887

(TTG)6

F: GGCATGACAATAATGTGAAGAGAG

R: ACCTCAGTTCCCTGATCATCTATC



55

M

267

9e-53

Zea mays alcohol dehydrogenase 1 (adh1A) gene

107

MPGC12

GF110888

(AAC)5 ATC (AAC)7

F: ACAAGGAGTGACACCTCTAACCTC

R: GCTTACAAATACACACGCACAATC



55

P

202

6e-30

Setaria italica transcription initiation factor IIF alpha

108

MPGC13

GF110889

(AAC)6

F: CTGAAGCATTCGATAAACTAGCTG

R: GTAGTGAAAAATGAGCAAGGGTCT



55

P

230

1e-56

Oryza sativa BAC clone

109

MPGC14

GF110890

(AAC)8

F: GATTGCATCAGTTTGACCTACTTG

R: AAAGATTTAGCCCTGGATAGGAGT



55

P

264

2e-54

Zea mays BAC clone CH201-227F5

110

MPGC15

GF110891

(AAC)7

F: CACAAGAGCAATAGAAGACCAGAA

R: ACCTTGAGCTTGTAAGGGACTATG



50

P

193, 368

4e-06

Takifugu rubripes clone 217A23

111

MPGC16

GF110892

(TTG)6

F: CTACACGCATTGACAACATATCCT

R: CTCCACATTAAAACAACCACAACC



55

M

297

-

No homology

112

MPGC17

GF110893

(AAC)4 GAC (AAC)6

F: GTACAAGCAGTGGGAAATCAGAAT

R: TCTTGTTGGGTTTTAACTCTAGCC



55

M

270

2e-101

Zea mays clone 1677620 mRNA sequence

113

MPGC18

GF110894

(AAC)5

F: AAAAATCTAGCCACCTCATCTCC

R: CTTTGTGGGTTGTGTTGTTGTACT



55

M

235

2e-06

serine/threonine-protein

phosphatase PP1-gamma catalytic subunit



114

MPGC19

GF110895

(AAC)8

F: GATTGCATCAGTTTGACCTACTTG

R: GTTGGATTTCAACTCTAGCCTACC



55

M

193

2e-58

Zea mays alcohol dehydrogenase 1

115

MPGC20

GF110896

(TTG)5

F: CCAGAGGCTCTATTGGTTAATTGT

R: CCAGACTGATCCTACTGTTGATTG



55

M

296

1e-22

Zea mays tartrate-resistant acid phosphatase type 5

116

MPGC21

GF110897

(TTG)6

F: AACTCTAGCCTACCCCAACTTTCT

R: GGTTGGACGACCTAGTTATGAAAT



55

M

286

1e-60

Zea mays alcohol dehydrogenase 1

117

MPGC22

GF110898

(AAC)7

F: GCTCTGGACTCACATGGTTATATG

R: CAACTCTAGCCTACCCCAACTTAC



55

P

108

1e-34

Oryza granulata chromosome 11 locus NP110

118

MPGC23

GF110899

(TTG)7

F: TAGCCTACCCCAACTTGC

R: AATGTGCCATCAGGAACAG



55

M

271

7e-44

Zea mays BAC clone

119

MPGC24

GF110900

(TTG)4 GGG (TTG)3

F: CACGCTGATGTGGTTGAC

R: CTGAGGGTAGCATTGTTAGAAG



55

P

134, 320

1e-59


Panicum virgatum clone PV_ABa003-D10

120

MPGC25

GF110901

(TTG)3 ACA (TTG)9

F: TGGGTGTTGATGTGGTTTAC

R: AGAATAGCACTGGACAAGTCAC



55

M

274

9e-81

Panicum virgatum clone PV_ABa003-D10

121

MPGC26

GF110902

(AAC)8

F: AATGATCGCCAACTTTAGAATC

R: AGTGGAAATTGAATACGAGGTC



55

M

189

5e-52

Sorghum bicolor hypothetical protein

122

MPGC27

GF110903

(TTG)8

F: TTGGGTTTCAACTCTAGCCTAC

R: GATCCTGAAGCATTCGATAAAC



55

M

171

6e-39

Zea mays ASF/SF2-like pre-mRNA splicing factor SRP30

123

MPGC28

GF110904

(AAC)7

F: ACGAGTTGGCTGGATAACC

R: ACCCTGATTTGTGGCTCTT



55

M

295

5e-52

Zea mays BAC clone CH201-227F5

124

MPGC29

GF110905

(TTG)12

F: CTTGGGACTGAAAGGCTATG

R: ATGCGTTTGGTGGTTTTG



55

M

204

2e-26

Pennisetum setaceum clone Penset95 microsatellite sequence

125

MPGC30

GF110906

(TTG)2 TGG(TTG)2

F: CTGGTAAGGGACTATGACATTG

R: TAGCAGCACATCAACAACAG



55

M

190

4e-16

Gossypium herbaceum simple sequence repeat

marker


126

MPGC31

GF110907

(AAC)2 AAT (AAC)4

F: GGTTTGCTGTGGTGTCAGTG

R: GTGGCTCATGAACTCCCTGT



55

M

237

2e-25

Zea diploperennis retrotransposable-like element DNA

127

MPGC32

GF110908

(TTG)12

F: GCACTGGGTGATAGTGAGCA

R: CCATGCAGGCTCATAAACAA



55

P

192

2e-50

Zea mays clone BAC

128

MPGC34

GF110910

(AAC)7

F: TTGCTGCTCTGCAACAACAT

R: GCCTCACCAGAAGTCATTCA



55

M

162

3e-100

Sorghum bicolor hypothetical protein

129

MPGC35

GF110911

(AAC)17

F: CCAACACCATGGCAGCTA

R: CTCCATGGTTTTCAGCCAGT



55

M

171, 202

5e-71

Zea mays BAC clone c573F08

130

MPGC36

GF110912

(AAC)12

F: CGTAGTGCCTCATCACAGGA

R: TGAACTCCCTGTGCCTATCC



55

P

230

1e-41

Zea mays cultivar B73 clone BAC c0171E08

131

MPGC37

GF110913

(AAC)7

F: TGCTCTGCAACAACATAGAGC

R: GCCTCACCAGAAGTCATTCA



55

M

158

3e-17

Oryza sativa Japonica Group genomic DNA

132

MPGC38

GF110928

(AAC)10

F: CATGCAGGGTAGAACGACAA

R: ACCACCTTCAGCCAATCATC



55

P

179, 200

7e-57

Panicum virgatum clone PV_ABa051-K10,

133

MPGC39

GF110914

(AAC)3 AAT (AAC)5

F: GGCTCAGCTCAACAACAACA

R: CACCGCCTTCAGTAGGTCAT



55

M

169

1e-26

Zea mays clone BAC c0017A20/c00174F14

134

MPGC40

GF110915

(AAC)3 CCC (AAC)5

F: CAACTCGGTAGCTGGACCAT

R: CTGAGCTTCGTGAGCCTCTT



55

P

169

2e-63

Panicum virgatum clone PV_ABa051-H05

135

MPGC41

GF110916

(AAC)6

F: CATCAGCCTTCTCCAACACA

R: GAGCTTCTTGAGCCTCTTGC



55

M

186

4e-66

Panicum virgatum clone PV_ABa003-D10

136

MPGC42

GF110917

(AAC)12

F: ACACCATAGGGGCAATTCAG

R: AGCAGGAATGTGGTGACTCC



55

P

354

9e-56

Zea mays BAC clone ZMMBBb-610A7


137

MPGC43

GF110918

(AAC)3 AAT (AAC)2 AAT (AAC)4

F: CGACATGGGAAAAGAGTCGT

R: CATCTAGCGGGTCTGGAGAG



55

M

154

7e-44

Zea mays cultivar B73 clone BAC c0171E08

138

MPGC44

GF110919

(AAC)2 ACC (AAC)7

F: TTTCCATGCAGGTTTAGCTC

R: ACCACCTTCAGCCAATCATC



55

P

178

7e-38

Panicum virgatum clone PV_ABa051-K10

139

MPGC45

GF110929

(AAC)7

F: GGCTGGATAACCCACTGAGA

R: ACCCTGATTTGTGGCTCTTG



55

M

238

1e-48

Panicum virgatum microsatellite PVSSR008

140

MPGC46

GF110920

(AAC)4 ACC (AAC)2

F: TTTCAACTGCCGTGAGACTG

R: ATGTGGTTTACACGGGCTCT



50

M

225

6e-115

Panicum virgatum clone PV_ABa003-D10

141

MPGC47

GF110921

(AAC)14

F: GTTGGCCATGCAGGCTTAG

R: ACCACCTTCAGCCAATCATC



55

P

192

6e-45

Panicum virgatum clone PV_ABa051-K10

142

MPGC48

GF110922

(AAC)2 N9 (AAC)3

F: GCATGCTTCAACTACCGTGA

R: CATCTGCTGGCTGTTGTTGT



55

M

186

4e-73

Panicum virgatum clone PV_ABa003-D10

143

MPGC49

GF110923

(AAC)8

F: CAGAACTTCACGAGCTTTGG

R: CCCTGATTTGTGGCTCTTGT



55

P

159

7e-57

Zea mays alcohol dehydrogenase 1 (adh1A) gene

144

MPGC50

GF110924

(AAC)8

F: CAAGAGCTTTGCAAGCAGATT

R: GTTTCAACTCTAGCCTACCC



55

P

396

2e-63

Oryza sativa genomic BAC clone H0425E08

145

MPGC51

GF110925

(AAC)4 AAT (AAC)3

F: ACAAAACCGCTGATCTGCTT

R: CCCTGATTTGTGGCTCTTGT



55

P

246

9e-37

Zea mays ACCase gene, intron containing colonist1

146

MPGC52

GF110926

(AAC)16

F: GCAGCTATGCAGGCTCAGTT

R: CTCCATGGTTTTCAGCCAGT



55

P

188

4e-54

Zea mays clone BAC 276N12-123C01

147

MPGC53

GF110927

(AAC)11

F: TTTGCTCCAATGACCAACAC

R: ACTATTCATGTGCCCGAACC



55

P

160

9e-62

Zea mays alcohol dehydrogenase 1 (adh1A) gene/ Panicum virgatum clone PV_ABa020-D05


+ F: Forward primer; R: Reverse primer





Поделитесь с Вашими друзьями:
  1   2   3




База данных защищена авторским правом ©shkola.of.by 2022
звярнуцца да адміністрацыі

    Галоўная старонка