Characteristics of microsatellite loci isolated from Solenosteira macrospira




Дата канвертавання24.04.2016
Памер46.04 Kb.
Table S1. Characteristics of microsatellite loci isolated from Solenosteira macrospira. Locus, primer sequence, repeat motif, range of repeat sizes (bp), number of alleles (NA), expected heterozygosity, and FIS and FST are indicated.

Locus

Sequence

Repeat motif

Size (bp)

NA

HE

FIS

FST

Soleno01

F: TCTGAAAATTCAAGTCGTTATGATTC

R: TGCCTTTGATATAATTACACGCTAAC



(CTT(T))n

249-270

16

0.664

0.017**

0.095**

Soleno13

F: TTTTTCGGCAAAGGAAAACC

R: GTGGCAGTGACCTTGAGTCTTC



(GA)13GAAGA(GAA)7A (GAA)7

100-121

15

0.814

0.013**

0.096**

Soleno14

F: AAAGAAGAAAAGAATTGAGGGATG

R: TGATTTAAATGAAAATCGGACAT



(AG)n…(AAG)n

159-214

14

0.766

0.007

0.132**

Soleno22

F: AGTCGGTGCTGTTACTTTGTGC

R: CTTTCCAATCTCAGCCAAAAAC



(GT)5…(GT)3GCGT(GC)5(GT)6

157-169

16

0.803

0.036**

0.046**

Soleno03

F: CGTCCTAACTAGTGGGGAAAAG

R: GATCATGTCACCGATTCCTC



(GAA)8GAG(GAA)7 (GGA)3

75-111

7

0.756

0.004

0.050**

Soleno11

F: CCAGGACACAGGTCATTTTTC

R: GCGTAGGAGTAACGCCACTG



(CTT)11CTGCTCCTG (CTT)36TTT(CTT)3

205-400

12

0.802

0.009

0.101**







Total (means)




13.3

0.768

0.014**

0.087**

*P < 0.05, **P < 0.001

Table S2. Pairwise F-statistics for Solenosteira macrospira between locations in the NGC. (a) FST for 6 microsatellite loci (above diagonal) and the Cal intron (below diagonal); (b) ST for 1390 bp of mitochondrial DNA (combined COI and CytB): ST considers genetic distance between haplotypes, FST does not (above diagonal) and geographical distances (km) assuming U-shaped dispersal across the south NGC (below diagonal); and (c) populations separated by open water (0), rocks (1), or sand (2). Shaded areas indicate significant values: *P < 0.05, **P < 0.01, ***P< 0.001.

(a)

PE

SF

PB

CC

LP

PP

AS

PE

--

0.112***

0.113***

0.088***

0.097***

0.059***

0.082***

SF

0.658***

--

0.002

0.051***

0.100***

0.105***

0.108***

PB

0.727***

0.027

--

0.039***

0.094***

0.110***

0.109***

CC

0.393***

0.083**

0.162**

--

0.088***

0.092***

0.069***

LP

0.257***

0.434***

0.482***

0.198***

--

0.024***

0.046***

PP

0.039*

0.443***

0.497***

0.206***

0.105***

--

0.020***

AS

0.165***

0.288***

0.367***

0.054*

0.103**

0.037

--

(b)


PE

SF

PB

CC

LP

PP

AS

PE

--

0.030*

0.025*

0.028*

0.397***

0.183***

0.023

SF

21.0

--

-0.014

0.036**

0.325***

0.164***

0.033*

PB

21.7

0.7

--

0.021

0.351***

0.167***

0.032*

CC

35.3

14.3

13.6

--

0.357***

0.169***

0.029*

LP

347.4

368.4

369.1

383.0

--

0.273***

0.213***

PP

266.4

287.4

288.1

301.0

81.0

--

0.123***

AS

211.4

233.1

232.4

247.0

136.0

55.0

--

(c)


PE

SF

PB

CC

LP

PP

AS

PE

--

1

1

1

0

0

0

SF




--

1

1

0

0

0

PB







--

1

0

0

0

CC










--

0

0

0

LP













--

2

2

PP
















--

2

AS



















--





База данных защищена авторским правом ©shkola.of.by 2016
звярнуцца да адміністрацыі

    Галоўная старонка