Supplementary Table 10. Primer sequences and pcr conditions for bisulfite pyrosequencing analysis. Gene 1st pcr pyrosequencing Forward primer Reverse primer Size (bp) Annealing Sequence primer Analyzed sites Sequence region




Дата канвертавання22.04.2016
Памер10.07 Kb.
Supplementary Table 10. Primer sequences and PCR conditions for bisulfite pyrosequencing analysis.




Gene 1st PCR Pyrosequencing

Forward primer Reverse primer Size (bp) Annealing Sequence primer Analyzed sites Sequence region


Apc TTAATAAGATGGAGAAGGTTTTGTGTTG CCCCAAACTCCCCCAAAAT 83 55 AGGGGGAGGAGTGTG 3 GTTGTYGGAAATTYGGTYGTT

Cdh13 GTTGGAGAGGTAGAGTTTTTTTTTAAAG TCACATTCCCTACCTAAAACAACAA 168 60 TTTAAGGAAAATATGTTTAGTG 4 TAGTYGYGTGTGTGAATGTAAAYGTYGTTA

Cdh4 AGGTAAGTGAGGGGAAAAGTA CAACCACAACACAAAACCTATA 126 60 AAGTGAGGGGAAAAGTAG 4 GGYGGGYGYGGGYGGAGTAT

Dok5 GATTGAGGGAGTGAAAGTTAATAAGGTGATG AACCCCCCACTTTCAAACTTTAA 100 60 GTGAAAGTTAATAAGGTGATG 4 YGGTGAAATTAGGYGTTAGAAGGYGTATATYGTT

Egfr AGAAGAGGAGGGAGGTTGTT CCCCCAAAACCTTATCTAATAAT 242 55 AGGAGAATGTTAGGAGAGA 4 GGAAGYGTTTTTYGYGAGGATYGAAAGT

Esr1 GTTTTTGAGGGGTAGAGTTATTTTGTAGAA TAAAAACTACAACCCCTAACCAATAACTTCCA 154 60 ATATAGGTGATTTAATTTTAAGG 3 AGYGTATTTAGAYGTTTTYGGGTTTTTTAA

Fbn1 GGTTAGGTAGGATTGGATTATT TATCCTCCCTTTCCACTC 110 50 GTTTTTTTTTAGGGTATTGA 4 TTTTGYGAATGAGGGAGGTTYGGGTTYGGGYGGTGGTT

Gpr37 AGTGTTGTGGGTTGTAGGA CTCCACAAACCAAATACTCTAC 211 60 GAGAGTGGTGTTTGGAAT 4 YGTTGTTGGYGGGYGGAGYGGTGTA

Hand2 ATTTTATGGTTATGAGTGGATAAT CAACAAAATCTCCATATACAACTACAT 193 50 TTAGTAAAGTGAATATTAAAAAGTT 5 TTATTGYGGAGAGYGYGAGGYGTYGTTTT

Hic1 AGGGGGGGTTTTTTTAAAT ATCCCCAAAACCTCATTAATT 115 55 TTATAGTTTTTTATTGGTTG 3 YGTTATTTTTYGTGGTTAAGTYGGAGA

Hoxa11 TTGGATTTGGGGTAGGTT CCCTACTCCTCTAACATATATTTACC 144 60 GAGGAGTAGGAGTATGTTATTG 3 GGYGYGAAGAYGGGGTTTGGGGT

Igf2-DMR1 GGTGATTTTAGAGTTTTTTTATTTGGTAAAG ATCACAACCTATAACCTATTTCAAAACCTAATCT 132 60 AAAGTTTAGGAGTTTATTTT 2 YGGGGTGTGAGTTAGYGGTT

Igf2-DMR2 TTTTTTTAGATATTTAGTGGGTAAGTTTTTTTAA CACCCAAAAAAACAAACAAACCT 95 60 TTTAATATGATATTTGGAGATAGT 4 TYGYGGGAYGTTTGYGTAGAGG

LINE-1 TGGGATTTTAAGATTTTTGGTGAG CTTCCCTATTTACCACAATCTCAA 86 60 TTTTTGGTGAGTGGAATATA 4 GYGTTTGTTTTAATTTAATYGYGYGG

Lrrtm1 TGTAGGTGTTGGAGGTGT* ACCTAACCCACTCATACCTT 156 50 TTTAGGAGGAGGGAA 4 GGAGTYGGGYGTTGTTTTGYGTTTYGTAAGG

Major satellite TATGGAGAGGAAAATTGAAAAAGG AATAATTTCCTCATTTTTCAAATC 133 60 TTTAGAAATGTTTATTGTAG 1 GAYGTGGA

Mgmt GGATTTAGGTTTTTTTTAGAGAGG CAAACCCACAACTCAATAATCAAC 238 60 TTAAGATTTGGTATTGAGAA 4 ATAYGGGTYGTAGGYGYGTGTA

Mlh1 AGTGTTGATTGGGTAGTATGAA ATTCCCTCAACTCTCAAAA 171 55 GGGTAGTATGAATGTTAGTTAAG 5 YGTTTTTATAYGTTAGTTTTTGGGATTTTTGTTTYGTTTTAAATAGYGGTTYGATA

Myod1 GGGAGGGGGAGTTTTAAGTTAATA AAACAAACTACACCAAATAACCAAATAC 186 60 TAGAGAGATTGGTAGTTATA 2 YGYGGTAG

Nkx2-5 GGGAGGTTGGGAAAGTAGGAGAG* CCCTAACCCCTACCTCCTACATACTAA 150 60 GGAGAGGGGTTTATTTT 7 YGYGYGTAGTTTTGTTAGGTYGGAYGTTGTYGTTTYGGGG

Nptx2 AGTTTTGGGGATTTTGTAT* CCCTTTCTTAAACTTAAAAAATA 184 50 GTAGGAGGATTAATTAGAGA 6 GYGYGGYGYGAGTTTTAYGYGTTTGT

p16 AGAGGAAGGAAGGAGGGATTTATTG AACCCCCCCCCTAACCAATCTA 141 60 GGAGGGATTTATTGGTTATA 5 YGATTGGGYGATTGGGYGGGTATTGAATTTTYGYGAGG

P2rx7 TGAGTGGAATAAATAAGAATTAAG CATCTTCTAAACACCATCTTTATAC 104 50 TTGGTTGGTAGATGATTT 4 YGTTTYGTTAGTTTTTTTTAGAYGTTYGTAT

p57Kip2 GGTGGGAGAGGTGGAGTAGATT AAATTCTCTCTAACCCTTAACCTCTAAACTATA 116 60 TTTGAGATGAGTTAGGTGA 4 GTTTGGYGTTTTTTAYGGGGGTYGYGGAGGGGT

Pcdh10 AGGAGATTGGTTGGTAGAA CCTACTTCAACCCCAATACTTAT 106 60 GGAGTTGAGTAAAAATAGAGAA 4 GYGGAGYGTTYGGAGTTTAGAAATTGTTAGTYGAGA

Pgr TTGGTTATTATAGTGGTGGATTTT CTAACTATCCCCCTCCAACAACTA 102 60 GTGTTTATTTTGTTTTTGAA 4 TTAYGTATTTTTGGTYGTTYGTATTYGGTAGTT

Prdm5 GGAGTTATAAATTTTGGGTTAATTAG* AATAAACTCCACTCCCAAAATC 141 50 TGGTTTGGGTTTTTTAT 6 YGTTTYGGTYGYGTTTGTTTYGGTYGAGGAGGGG

Rarb GTGATAGAAGTGGTAGGAAGTGAGTTGT* CCCTCCTCTACATCCCAATCTTATA 115 55 GGGGGGATTAGAGTTT 4 TYGTGYGTYGYGGTTA

Rassf1 TGTTAATAGAGGTTTTTTTATTTAGTGGGTTATTT CAAACCCCCAACAATCCAA 137 55 ATTGTAAGTTTATTTGTTATTAT 5 YGTTGTYGYGYGTTYGTTT

SINE B1 TTTTGGTTGTTTTGGAATTTATT CCTTTAATCCCAACACTTAAAAAA 92 60 ATTCTGTAGATTAGGTTGGT 2 TTYGAATTTAGAAATTYGTT

Timp3 TGTTTAGTAGGGTTATTTGGAAGGTATTT CAAACCCAAACCAAAAAATCAT 190 55 GGTAATTTTGAAGAAAAGAG 3 YGGTAGTTTTYGTAGYGGATTAT

Tmeff2 AGGGAGGGTTAAGGATTTGTTGT* AAAAAAAACCCCACCAAACTAAATA 126 55 GATTTGTTGTTTTTTAAAAGTTAGAGGGATG 6 YGGGYGGTAGAGYGYGAGAGGYGGYGGTTGGGTTG

Trip6 AGGGGAAGGATTGTAGAAT* ACTCCCCCAAAAAAACTT 136 50 TGATTTTTTTTTGGAATG 3 TGGTGAYGTTAGGGGGYGTGGTYGTTTTTAAAAT

Tusc3 TTGGGTTAGAGGTGAAAGTAAG AACCTCTCCTAACCAAAACCT 252 55 TATTTAGTTTTTTGGAGAAG 2 TYGTTGTTATTTYGAGGTTT

Vcan GGGGTGGAAATTTATTGTTGAGT ACCACCCCCCTTCCTATATAATCT 76 60 GAGTTGTGAGAAAGGGTT 3 TYGYGTTGTTTYGGAAGA

Wt1 GGAAGGTTAGTTAGGGTAGTAG CCCTCCATTCACACAA 188 60 AGTTTTATATTTTAGGTGTTAGTAAT 4 YGGGAYGAGTAGYGYGTT

We used UNIV-reverse primer and Biotin-UNIV primer for 2nd PCR. Annealing temperature is same as 1st PCR.



*; forward and UNIV-reverse primer for 1st PCR, forward and Biotin-UNIV primer for 2nd PCR.

YG; CpG site for pyrosequencing analysis.


База данных защищена авторским правом ©shkola.of.by 2016
звярнуцца да адміністрацыі

    Галоўная старонка