Supplementary Methods




Дата канвертавання21.04.2016
Памер46.94 Kb.
Supplementary Methods

To first obtain information about which ancient retroposon types were active in deep bird branches, we screened the entire zebra finch (Taeniopygia guttata) genome for CR1 transpositions in transpositions (TinT; http://www.compgen.uni-muenster.de/tools; Churakov et al. 2010a; Supplementary figure S3). We then computationally screened these ancient families of retroposons for phylogenetically informative markers applying three strategies:



Marker selection

(1) To obtain information about the locations of introns in the still incompletely annotated zebra finch genome (Taeniopygia guttata), we downloaded ~8,000 well-annotated short introns (100-1,200 nt; http://genome.ucsc.edu/cgi-bin/hgTables?org=Chicken&db=galGal3) from domestic fowl (Gallus gallus genome 3rd edition) and compiled them in a local BLAST database. We then screened the zebra finch genome draft assembly (http://hgdownload.cse.ucsc.edu/downloads.html#zebra_finch) for TinT-selected, potentially informative CR1 families (http://www.repeatmasker.org/RMDownload.html), extracting ~100,000 loci with 700-nt flanking sequences (mainly with elements of the CR1-J2 and CR1-E_Pass families; see figure 3) that were then blasted against the compiled domestic fowl intron database. About 700 derived zebra finch introns with specific CR1 insertions plus their flanking conserved exonic sequences (essential for primer construction) were identified and verified manually using the sequence editor Se-Al v2.0 (Rambaut 2002). PCR primers were generated from 127 of these and investigated in 26 representative bird species. Markers resulting from strategy (1) were ZF-6, ZF-9, ZF-10, ZF-14, ZF-19, ZF-32, ZF-42, and ZF-89.

(2) We extracted about 450 CR1 and LTR insertions, including their respective ~300-nt flanks, from available traces of the California condor (Gymnogyps californianus) (ftp://ftp.ncbi.nih.gov/pub/TraceDB/gymnogyps_californianus), blasted these sequences against the zebra finch and domestic fowl genomes, and selected 30 insertions with conserved flanks for primer construction. Markers resulting from strategy (2)) were GyD06, GyD11, and GyF14.

(3) We generated 3-way alignments for available California condor trace sequences with zebra finch and domestic fowl genomes, and selected 4 loci with CR1/LTR elements present in California condor and zebra finch and absent in domestic fowl. Marker resulting from strategy (3) was Gym1.



Cummulative TinT

To gain a quantitative indication of the ancestral retroposon fixation probability that is possibly correlated with the historical population structure (average number of generations necessary for fixation is close to four times the effective population size: t = 4Ne; Kimura and Ohta 1968), we summed the individual element fixation probabilities with CR1 specific parameters (Supplementary figure S2) to derive a cumulative TinT (fig. 3). An automated application to do this and all data are now available at http://www.compgen.uni-muenster.de/tools.



PCR amplification

From the ~100,000 computationally selected genomic loci from the above strategies, 161 were PCR amplified and sequenced in 26 representative bird species (with some replacements by alternative species of the same taxon; see fig. 1). For the 12 presented informative loci we derived an almost full-species representation. DNA was derived from tissue and blood samples using conventional phenol-chloroform extraction. PCR primers were designed in conserved sequence regions and PCR reactions and cloning were performed under standard conditions (see Kriegs et al. 2007). Sequences were derived via the Seqlab sequencing service, Göttingen, Germany, using standard M13 primers. GenBank accession numbers of the loci are JN583887-JN584160.


Species names

Taeniopygia guttata (zebra finch), Nestor notabilis (kea), Ara ararauna (blue-and-yellow macaw), Psittacula krameri (rose-ringed parakeet), Falco sparverius (American kestrel), Asio otus (long-eared owl), Aegolius funereus (Tengmalm´s owl), Picus viridis (Eurasian green woodpecker), Jynx torquilla (Eurasian wryneck), Trogon viridis (green-backed trogon), Gyps fulvus (griffon vulture), Cathartes aura (turkey vulture), Gymnogyps californianus (California condor), Coragyps atratus (black vulture), Urocolius macrourus (blue-naped mousebird), Colius colius (white-backed mousebird), Larus ridibundus (black-headed gull), Ciconia ciconia (white stork), Egretta garzetta (little egret), Butorides striata (striated heron), Spheniscus humboldti (humboldt penguin), Balearica pavonina (black crowned crane), Musophaga rossae (Ross´s turaco), Cuculus canorus (common cuckoo), Carpococcyx renauldi (coral-billed ground cuckoo), Columba palumbus (common wood pigeon), Apus apus (common swift), Chrysolampis mosquitus (Ruby-topaz hummingbird), Opisthocomus hoazin (hoatzin), Tachybaptus ruficollis (little grebe), Phoenicopterus chilensis (Chilean flamingo), Gallus gallus (red junglefowl, chicken), Anas crecca (common teal), Eudromia elegans (elegant crested tinamou), Struthio camelus (ostrich).

PCR primers/alternative primers and amplification temperatures

Loci


Sequence in 5’-3’ orientation

Forward/reverse

Tm

°C

ZF06

GGARATTCCTAATCTCTCAGATG

AGGCTCATCTTTAGCAAGG



58

ZF14

CTAAACGTTGCCTGAAGTG

GCTGACAGAAGACTGTGTAAGT



57




GGGCTACATCTTGTTCCTGC

CTGACATTGCGGGGAGC



63

Gy11

AAATTACTGACTTRCCATTATGA

AAACTGCTGCTGTTGGC



57




ACTCAACTTGGTTTTGGARCTG

CACAGTCCCAYAGATTCCAATAC



62




AACCATCTTCCCATCTATCTCAC

CAAAGTAACCCARTTCTTCCTT



62




GCCAAATCGCTGCTTATG

AGTAATTGTAGATTTTGCCATTC



60

ZF19

GYCAGACTTCTTATGATGACCT

AAACACTGTGCGACATTTAG



56




CCCTCTTTGTTAATCAGGTGAG

GCAATCTGGTGATCAAGACG



62




TTGTAGAGGTTTTCAAGCCAG

CCTTCAATCTTCTGGGCAG



61

Gy14

TCAGCCTTATATGATGCCTCCAC

ACTTCACAATGCCATAACATACCAG



59




CCTTATATGATGCCTCCACC

GAACAAAAAAACTGATGGTCA



59




CTCAGCTGCATTACAATGGTC

CCACCTTGTAGTCTAGCAAACTC



62




TTTGCATTTATAGCTACTTTAGC

TACTCTTTGCAGCTATTAAGATC



59

ZF42

TGGGACTACAGCAAAGGAAAG

TTGGCAAATATGCAGTACTTCTC



64

ZF09

GCCAAGGAGAATACATTGC

TCTCAGCATCAGGAACCAC



59




TATCAGAAGTGCTCCTGTAGCC

CCACTATACCTATTAGAAAAGACTG



60

ZF10

AAGCTCTACAAGTCCATGAAG

GAGGGTCCTCTCATCTGTG



57

ZF89

TGCACTATGACCTTGTTCAGC

GGATGGACTCCACAGATGC



61

GyD6

GTTTAAAATGCCTCAAGTTGTGA

TGAGCCCAGTTCTGAAGTCAAT



55




AATTTTCCATTCAATTCATGG

AATGCACATTCAGCACTGG



60




ATTCATGGGGATAGAAGATAGAGT

AGATCACATATTCATCCATATTGC



55




CCTCAAGTTGTGATGAATTTTC

TTYTCCTGAGTTTAAAAGTTCAC



60




GGTAGAAGTTAGAGTAGGTGAACC

TAGTATGATACTTCTAAAGCAAGTC



58

ZF32

TCAGAAGTGATATTCTTGAGC

GATGAGTTCTGAAGCACAAG



54




CATCTCCTGTCAGCCACTTC

CACAACAATATTGGACAGCAAG



61

Gym1

TATYTCARGTGCAGCCATTT

TGACCACARGGACAATCCTG



60




TCCTTSTGGYGCAGCACAG

TGGAGRCAGCTACAGYTTTCATG



63




ACCAGTTAATGATATGCAAACTC

CTAGTCCAGCTAGAAAACCTG



58



References

Kimura M, Ohta T. 1963. The average number of generations until fixation of a mutant gene in a finite population. Genetics 61:763-771.

Kriegs JO, Matzke A, Churakov G, Kuritzin A, Mayr G, Brosius J, Schmitz J. 2007. Waves of genomic hitchhikers shed light on the evolution of gamebirds (Aves: Galliformes). BMC Evol Biol. 7:190.

Rambaut A. 2002 Se-Al: Sequence alignment editor. Available: http://tree.bio.ed.ac.uk/software/seal/.








База данных защищена авторским правом ©shkola.of.by 2016
звярнуцца да адміністрацыі

    Галоўная старонка