Supplementary Methods Stable Isotope Measurements of Niche Shifts




Дата канвертавання19.04.2016
Памер8.78 Kb.
Supplementary Methods
Stable Isotope Measurements of Niche Shifts. We used mushrooms that were recently collected, free of soil and plant debris, and with no signs of degradation. Samples were run in triplicate on an Eurovector Elemental Analyzer configured with a micromass stable isotope ratio mass spectrometer at Johns Hopkins University, or at the University of Hawaii at Honolulu. Stable isotope abundances are reported as  according to the following equation:
X= (Rsample/Rstandard – 1) X 1000 (‰)
where Rsample and Rstandard are the ratios of heavy to light isotopes of sampled mushrooms and standards, used and X is either carbon (C) or nitrogen (N). Vienna Pee Dee Belemnite was used as a standard for C, and mean air was used as a standard for N.
Host Selectivity within Californian Forests. The composition of ectomycorrhizal hosts at Heart’s Desire is Quercus agrifolia (Fagaceae), Lithocarpus densiflorus (Fagaceae), Arbutus menziesii (Ericaceae), and Pinus muricata (Pinaceae) while at both Drake’s Landing and Horse’s Trail Q. agrifolia (Fagaceae), L. densiflorus (Fagaceae), Pseudotsuga menziesii (Pinaceae) and Corylus cornuta var. californica (Betulaceae) are the EM hosts. The plot at Heart’s Desire was 25 X 10 m, while the plots at Drake’s Landing and Horse’s Trail were 20 X 20 m. Plots were different sizes based on proximity to roads, trails and other features of the landscape. The sites were chosen based on the relative abundance of A. phalloides and mix of potential ectomycorrhizal hosts at each site.

Root tips whose morphological characteristics identified them as A. phalloides (Supplementary Figure 2) were isolated and stored in CTAB buffer, as previously described (1). At Horse’s Trail, root tips were collected in December of 2007 and 2008; at Heart’s Desire and Drake’s Landing, root tips were extracted in December of 2006, 2007 and 2008. December is the peak fruiting time of A. phalloides in these forests. The total number of unique soil samples where A. phalloides root tips were found varied (Drake’s Landing: 19; Heart’s Desire: 21; Horse’s Trail: 14) because of differences in the number of mushrooms at each site and because we were variably successful at finding root tips (see results).

From each soil sample, we extracted DNA from up to three A. phalloides root tips, but only if each root tip was found on a different root section DNA was extracted from each root tip and aboveground host tissue using a chloroform extraction procedure (1). To confirm that each root tip was indeed A. phalloides, root tips were screened with an A. phalloides specific primer set (1). The same DNA extraction protocol was used for the host plant tissue. The species of host plant in each EM root tip was determined by first amplifying a portion of the chloroplast intergenic spacer between the trnL exon and trnF region, using the primers trnL_e and trnL_f (2). This PCR amplicon was then digested with the restriction enzyme Hinf1 according to the manufacturer’s instructions (New England Biolabs, Ipswitch, Massachusetts, USA) and visualized on a 2% agarose gel. Root trnL restriction fragment length polymorphisms (RFLPs) were compared with RFLPs of host tissue to identify the host plant species of each root. All potential hosts except those in the Fagaceae (Quercus and Lithocarpus) could be differentiated based on the trnL-RFLP. To differentiate between Q. agrifolia and L. densiflorus, we sequenced a portion of the ITS region of Fagaceae root tips using the primers ITS5A (CCTTATCATTTAGAGGAAGGAG) (3) and the newly designed reverse primer OakITS1-1R (ATCCGTTGCCGAGAGTCGT) (Table S5).

To survey the abundance of tree roots in the three plots where we sampled root tips, we took a soil core from 10 randomly selected locations within each plot to the same depth as was used for collection of the EM root tips. Woody roots were removed from each core by washing the cores with water over a 2 mm sieve. In the lab, roots were cut into 1-4 cm sections. Four root sections were randomly selected and identified using the same protocols for ectomycorrhizal root tips (see Supplementary Material). For roots where RFLP patterns did not match patterns from host tissue collected at the site, we directly sequenced the trnL region and determined the host identification using BLASTn searches of GenBank.


1. Wolfe BE, Richard F, Cross HB, Pringle A (2010) Distribution and abundance of the introduced ectomycorrhizal fungus Amanita phalloides in North America. New Phytol 185:803-816.

2. Taberlet P, Gielly L, Pautou G, Bouvet J (1991) Universal primers for amplification of 3 noncoding regions of chloroplast DNA. Plant Mol Biol 17:1105-1109.



3. Stanford AM, Harden R, Parks CR (2000) Phylogeny and biogeography of Juglans (Juglandaceae) based on matK and ITS sequence data. Am J Bot 87:872-882.


База данных защищена авторским правом ©shkola.of.by 2016
звярнуцца да адміністрацыі

    Галоўная старонка