Supplementary material for Gratia et al. “Inhibition of ampk signalling by doxorubicin at the crossroads of the cardiac responses to energetic, oxidative and genotoxic stress” Supplementary Material and Methods dna damage quantification




Дата канвертавання26.04.2016
Памер37.02 Kb.


S
Gratia et al.: Inhibition of AMPK signalling by doxorubicin

Supplementary material for Gratia et al.
“Inhibition of AMPK signalling by doxorubicin - at the crossroads of the cardiac responses to energetic, oxidative and genotoxic stress”


Supplementary Material and Methods

DNA damage quantification

Long PCR was performed in a final volume of 25 μl using a GeneAmp PCRSystem 9700 (PE Applied Biosystems). Specific primers (see below) amplified a 15.988-kb fragment of the mitochondrial DNA (mtDNA) and a 12.5-k fragment of the nuclear TRPM-2 gene (nDNA). The reaction mixture contained 25-75 ng template total DNA, 2.5 μl buffer 1, 200 μM dNTPs, 0.5 μM of each primer and 0.5 μl of Advantage 2 polymerase (EuroClone, Milan, Italy). Long mt and n PCR products were quantified by Sybr Green Real-Time PCR, using primers localized in the middle of the long PCR fragments: Rattus ND1 F and Rattus ND1R for mtDNA and Rattus 100F and Rattus 100R for nDNA. Quantitative Real-Time PCR was performed in a Bio-Rad iCycler iQ Multi-Color Real-Time PCR Detection System using 2× Quantitect SYBR Green PCR kit (Qiagen). Primer nucleotide sequences and PCR parameters are given below. The quantitative PCR reaction was performed at 95°C for 10 min to activate HotStart DNA polymerase followed by 50 cycles of the two-step at 95°C for 30 s and at 60°C for 30 s. The specificity of the amplification products obtained was confirmed by examining thermal denaturation plots and by sample separation in a 3% DNA agarose gel. Results were normalized by quantifying each sample for the amount of initial genomic DNA without previous long PCR amplification, in the same real time PCR conditions, using the method described by Pfaffl.1 Appropriate dilutions used were 1x10-3 for the Long and 0.01 ng of genomic DNA. Each sample was tested in triplicate.


Employed primers
15.988 kb, mitochondrial fragment

16Rat F 5’-TACCTCCCCACCATCAACACCC-3’

16RATTUSR2 5’-CTACGACTCCTCCTAGTTTGTTG-3’
100 bp, mitochondrial fragment

ND1 F 5’-CAGAAACAAATCGAGCTCCC-3’

ND1 R 5’- AAGAATAGGGCGAATGGTCC- 3’
12.5-kb, nuclear fragment

Rattus n F AGACGGGTGAGACAGCTGCACCTTTTC

Rattus n R CGAGAGCATCAAGTGCAGGCATTAGAG
100 bp, nuclear fragment

Rattus 100F CTGGAAAAGGGCAGCACAGT

Rattus 100R AGGAAAGGCGGGTTTCCAGA
Thermal cycling parameters in mitochondrial Long PCR





cycles

temperature

time

15.988 kb

mitochondrial fragment

1x

95°C

1 min

24x

94°C

30 sec

68°C

16 min

1x

68°C

7 min

1x

4°C




Immunoblotting and immunoprecipitation

Freeze-clamped hearts were powdered in liquid nitrogen and homogenized in 50 mM Tris-HCl pH 7.5, 1 mM EDTA, 1 mM EGTA, 1 mM DTT containing protease and phosphatase inhibitors. Protein concentration was determined with Biorad reagent (Reinach, Switzerland) using BSA as a standard. Homogenates were either used immediately or stored at -80°C. Fifty μg protein/lane were separated on 7.5%, 10% or 12% polyacrylamide gels and transferred to nitrocellulose membrane (Hybond ECL, GE Healthcare, Buckinghamshire, UK) by wet or semi-dry blotting. After blocking in 5% milk, TBS, and 0.1% Tween 20, blots were immunostained with primary antibody overnight at 4°C, then washed and incubated for 1 h at room temperature with horseradish peroxidase-conjugated secondary antibody. Immunoreactive bands were detected using a chemiluminescence kit (ECL plus, GE Healthcare) and a CCD camera (ImagerQuant LAS 4000, GE Healthcare). The following primary antibodies were used: from Cell Signaling (Beverly, MA) anti-AMPK rabbit polyclonal 1:1000, anti-phosphoThr-172AMPK 1:400, anti-ACC 1:1000, anti-phosphoSer79-ACC 1:1000, anti-mTOR 1:1000, anti-phosphoSer2448-mTOR 1:500; anti-phosphoThr1462-TSC2 1:1000; anti-Akt 1:1000, anti-phosphoSer473-Akt, 1:1000, anti-phosphoThr308-Akt 1:1000, anti-phosphoThr389-p70 S6 kinase 1:1000, anti-GSK 3β 1:1000, anti-phosphoSer9-GSK 3β 1:1000, anti-α-tubulin 1:1000, anti-acetylated-lysine, anti-SAPK/JNK 1:1000, anti-phosphoThr183/Tyr185-SAPK/JNK 1:1000, anti-p38 1:1000, anti-phosphoThr180/Tyr182-p38 1:1000, anti-phospho-(Ser/Thr) Akt Substrate Motif (RXXS/T) 1:1000; from Sigma (Saint Louis, MO) anti-LKB1 1:500, anti-ERK-1/2 1:10000, anti-phosphoThr202/Tyr204-ERK-1/2 1:10000; from Abgent (San Diego, CA) anti-SIRT1 (1:500), anti-phosphoSer2612-DNA-PK 1:500; from Santa Cruz Biotechnology (Santa Cruz, CA) anti-GAPDH 1:250, anti-CamKKβ 1:200; from Alpha Diagnostics Intl (San Antonio, TX) anti-HNE (4-hydroxy-2-nonenal) 1:1000; from Spring Bioscience (Fremont, CA, USA) anti-CamKKα 1:500; from BD Biosciences Pharmingen (Franklin Lakes, NJ, USA) anti-PARP (1:2000). Primary antibody against BCK isoenzymes have been generated and characterized previously in our laboratory.2 As a positive control for apoptosis, a lysate of camptothecin-treated Jurkat cells (BD Biosciences Pharmingen) was used. Band intensities were quantified with ImageQuantTL (GE Healthcare) and normalized with respect to glyceraldehyde 3-phosphate dehydrogenase (GAPDH) or tubulin signals, or in case of phosphoprotein signals with respect to the corresponding total protein signal. Data are given as ratios of DXR-treated sample relative to control sample.

To detect acetylated LKB1, acetylated proteins were first immunoprecipitated from heart homogenate (70 g protein) using anti-acetylated lysine antibody (1:100, Cell Signaling) in PBS, 1% BSA for 2 h at room temperature (total volume 300 µl). After addition of 200 μg Dynabeads M-280 with immobilized sheep anti-rabbit IgG (Invitrogen), samples were incubated for 1 h at room temperature. Dynabeads were washed 6 times using PBS, 0.1% Tween 20, resuspended in Laemmli sample buffer, and denatured proteins separated on standard SDS-PAGE and immunoblotted as described above, using anti-LKB1 as primary antibody.
Determination of phosphatase activity

Protein phosphatase activity was measured in perfused heart homogenates (3 μg) using serine/threonine phosphatase assay (Promega, Madison, WI). Endogenous phosphates were removed using Spin Columns (Sephades G-25 resin) twice. Homogenates were incubated with reaction mix (250 mM imidazole pH 7,2, 1 mM EGTA, 25 mM MgCl2, 0,1 % β-mercaptoethanol, 0,5 g/l BSA) and 100 µM phosphopeptide substrate at 37°C for 45 min in a 96-well plate. To stop the reaction, 50 µl of molybdate dye/additive mixture was added to the wells, and the absorbance at 600 nm was recorded using ELx808 Absorbance Microplate Reader (Biotek, Winooski, VT). Each measurement was done in triplicate.


References cited in Supplementary Material and Methods

1. Pfaffl MW. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res 2001;29:e45.



2. Schlattner U, Mockli N, Speer O, Werner S, Wallimann T. Creatine kinase and creatine transporter in normal, wounded, and diseased skin. J Invest Dermatol 2002;118:416-423.

Supplementary Table

Table S1 Adenine nucleotide levels in doxorubicin-perfused hearts




ATP

ADP

AMP

ATP+ADP+AMP

Control

20,8 ± 2,2

4,1 ± 0, 4

0,41 ± 0,16

25,3 ± 2,4

DXR 5 µM

19,3 ± 1,3

4,0 ± 0,2

0,63 ± 0,25

24,0 ± 1,3

DXR 25 µM

18,7 ± 4,0

4,1 ± 0,8

0,60 ± 0,08

23,5 ± 4,7

Values are expressed as mean ± SD (n ≥ 4) in μmol/g dry weight.

Supplementary Figures

Figure S1 Time-course of cardiac function in perfused rat hearts. Isolated rat hearts were perfused without (Control) or with DXR at 5 µM (DXR5) or 25 µM (DXR25), and in addition with Akt inhibitor MK2206 (1 µM) alone (MK2206) or in presence of additional 25 µM DXR (MK2206+DXR25). Functional parameters: developed pressure (DP), end-diastolic pressure (EDP), dP/dt, -dP/dt, heart rate (HR), rate pressure product (RPP). Data represent percentages of baseline values obtained after 30 min of stabilization (control: n = 7; 5 µM DXR: n = 7; 25 µM DXR: n = 4; MK2206: n = 3; MK2206+DXR25: n = 3).



Figure S2 Doxorubicin does not negatively affect AMPK upstream signalling in vivo. Effects of DXR on AMPK upstream signalling in hearts of in vivo treated rats. Total CamKKα, and CamKKβ, as well as phosphorylated LKB1 were probed by immunoblot. The GAPDH signal was used for normalization. *P < 0.05 vs control (n = 7).


Figure S3 Doxorubicin does not increase the level of protein-HNE adducts. Protein-HNE adducts probed by immunoblot (left) in total homogenates from isolated perfused rat hearts (A; n ≥ 4) and from hearts of in vivo treated rats (B; n = 7). Ponceau protein staining is given as loading control (right).


Figure S4 Doxorubicin does not change activity of protein phosphatase PP2C. Activity of serine/threonine protein phosphatase PP2C was measured by an enzymatic assay in total homogenates from isolated perfused rat hearts (n ≥ 3).



Figure S5 Doxorubicin induces phosphorylation of multiple Akt substrates. P-Akt substrates were collectively probed by immunoblot with Akt substrate motif-specific antibody (left) in total homogenates from hearts of in vivo treated rats (n = 7). Ponceau protein staining is given as loading control (right).


Figure S6 Akt inhibitor MK2206 prevents Akt downstream signalling. Phosphorylation of Akt substrates TSC2, mTOR, and GSK (A) and collective Akt substrate phosphorylation as revealed by an antibody specific for phosphorylated Akt substrate motif (B) in rat hearts perfused without (control) or with 1 µM MK2206, and with additional 25 µM DXR. Immunoblot analysis; tubulin signal used for normalization (A). *P < 0.05 vs control (n = 3). Ponceau protein staining is given as loading control (B, bottom).


Figure S7 Specificity of Akt inhibitor MK2206: no inhibition of ERK and DNA-PK phosphorylation. Effect of MK2206 on phosphorylation of ERK and DNA-PK in rat hearts perfused without (control) or with 1 µM MK2206, and with additional 25 µM DXR. Immunoblot analysis; total protein or tubulin signals were used for normalization. *P < 0.05 vs control (n = 3).


Figure S8 Doxorubicin increases brain-type creatine kinase protein. BCK protein in isolated perfused rat hearts (A) and from hearts of in vivo treated rats (B). Immunoblot analysis; tubulin or GAPDH signals used for normalization. *P < 0.05, **P < 0.01 vs control (A: n ≥ 4, B: n = 7).


База данных защищена авторским правом ©shkola.of.by 2016
звярнуцца да адміністрацыі

    Галоўная старонка