Supplementary Information




старонка1/3
Дата канвертавання19.04.2016
Памер188.39 Kb.
  1   2   3
Supplementary Information

Population genetic structure of serotine bats (Eptesicus serotinus) across Europe and implications for the potential spread of bat rabies (European Bat Lyssavirus EBLV-1).



Moussy C, Atterby H, Teacher AGF, Allnut TR, Mathews F, Smith GC, Aegerter JN, Bearhop S, Hosken DJ

Contents:

Table S1 Details of the sampling locations included in this study.

Table S2 Details of the microsatellite markers used.

Table S3 Genetic indices for nuclear and mitochondrial markers for each location.

Table S4 Demographic analysis carried out on each mitochondrial population.

Figure S1 Results of the STRUCTURE analysis.

Figure S2 Results of the sPCA analyses on nuclear and mitochondrial markers.

Figure S3 Mantel tests for isolation by distance among roosts.

Figure S4 Pairwise mismatch distributions for mitochondrial haplotypes.

Supporting Information Reference

Table S1: Geographic location (WGS 1984 coordinates), sample type, habitat and sampling period for the E. serotinus samples included in this study
* sampled summer and autumn 2010

Location code

Country

Longitude

Latitude

Sample type

Habitat

Summer sampling period

N genotyped

N sequenced

GG

Georgia

45.11

41.45

Live bats

Forest

2008

15

0

SL

Slovakia

20.97

48.68

Live bats

Cave

2011

4

1

PL1

Poland

18.12

50.20

Live bats

Building

2008

20

3

PL2

Poland

20.50

52.15

Live bats

Building

2009

15

6

PL3

Poland

23.13

53.40

Live bats

Building

2010

12

6

CH

Switzerland

6.52

46.79

Live bats

Cave

2010*

9

1

IT

Italy

9.04

45.62

Live bats

Building

2010

12

4

FR

France

2.40

47.10

Museum

Originating from maternity roosts in local area

2004-2010

19

11

UK1

England

0.98

51.21

Live bats

Building

2004; 2010

57

36

UK2

England

-0.03

51.04

Live bats

Building

2004-2005

14

10

UK3

England

-0.06

50.91

Live bats

Building

2011

5

3

UK4

England

-0.13

50.85

Live bats

Building

2004; 2011

68

39

UK5

England

-0.18

50.94

Live bats

Building

2005-2006

8

5

UK6

England

-0.45

50.95

Live bats

Building

2004-2005

16

9

UK7

England

-0.19

51.20

Live bats

Building

2010-2011

22

14

UK8

England

-0.40

51.37

Live bats

Building

2010-2011

23

20

UK9

England

-0.22

52.13

Live bats

Building

2010-2011

11

11

UK10

England

0.44

52.30

Live bats

Building

2010-2011

11

11

UK11

England

-0.81

50.84

Live bats

Building

2011

7

5

UK12

England

-0.99

50.86

Live bats

Building

2010-2011

26

15

UK13

England

-1.56

51.24

Live bats

Building

2010

8

7

UK14

England

-2.05

51.47

Live bats

Building

2011

14

13

UK15

England

-2.35

51.42

Live bats

Building

2010-2011

39

27

UK16

England

-2.37

51.40

Live bats

Building

2004-2006

48

42

UK17

England

-2.86

51.32

Live bats

Building

2006

21

19

UK18

England

-2.70

51.30

Live bats

Building

2011

6

3

UK19

England

-2.61

51.23

Live bats

Building

2005-2006; 2010-2011

42

19

UK20

England

-2.31

51.01

Live bats

Building

2005-2006

25

12

UK21

England

-2.18

50.86

Live bats

Building

2010-2011

10

7

UK22

England

-2.74

50.73

Live bats

Building

2010-2011

24

15

UK23

England

-2.73

50.76

Live bats

Building

2010-2011

30

27

UK24

England

-2.90

50.92

Live bats

Building

2006

15

7

UK25

England

-1.15

50.67

Live bats

Building

2010-2011

13

6

UK26

England

-1.19

50.67

Live bats

Building

2011

7

4

UK27

England

-1.21

50.71

Live bats

Building

2010-2011

11

11

UK28

England

-1.29

50.69

Live bats

Building

2010

12

12


Table S2: Microsatellites markers
A ‘pig-tailing’ modification (GTTTCTT) was added to the 5’ end of D15, B22 and TT20 to reduce non-templated addition of primarily adenosine nucleotides (Brownstein et al. 1996), which could otherwise lead to problems in accurate sizing of the DNA fragment. TD indicates a Touch-Down PCR method.

Locus

Forward and reverse sequence

5’ to 3’


Microsatellite repeat

Annealing temperature (C)

Number of alleles

Allele size range (bp)

Set

Reference

Paur05


F: 6-FAM-GGACAGTATGCCATGTTATGCTG
R: GCACTTTCACAAACCTAGATGG

(GT)10

66-56 TD

11

231-253

2

(Burland et al. 1998)

AF141650


F: HEX-ACAGGAACCCTCAGAAGTGG

R: TGGTCTCCTTTTCTTCACTTTGT



(TATC)9

52

11

265-311

2

(Petit & Mayer 1999)

NN8 = Mu438+9

F: NED-TTGTGTTTTAAAGAAAATCC

R: ATAGGTGATTTCCATTCCCA



(GT/CA)21

44

4

141-163

1

(Petri et al. 1997)

EF1

F: 6-FAM-ATCTGGGCAATGATACCTTT

R: GCAGGCTGGGCTGAG



(GT)22CT(GT)17

50

3

177-194

1

(Vonhof et al. 2002)

EF4

F: HEX-ATAGGCTCCCAGAAATAGC

R: GATCACCACAAAATGTGC



(CT)4(GT)17

48

6

217-227

1

(Vonhof et al. 2002)

EF6

F: HEX-ATCACATTTTTGAAGCAT

R: ATCTGTTTTTCTCTCCTTAT



(GT)20

41

16

161-197

2

(Vonhof et al. 2002)

EF14

F: HEX-ATCATATATTTGTGTTCTGG

R: AAAATCAGCTATGTAGCAC



(GT)19

43

12

107-129

1

(Vonhof et al. 2002)

EF15

F: NED-AGCAGCAAAGGGGACTCAGA

R: GAGAAGCAGGGAGGGCATTT



(CA)3GA(CA)20

55

18

107-147

2

(Vonhof et al. 2002)

D15

F: 6-FAM-GCTCTCTGAAGAGGCCCTG

R: GTTTCTTATTCCAAGAGTGACAGCATCC



(AC)17

61

10

127-151

4

(Castella and Ruedi 2000)

B22

F: HEX-CTGATGCAAGACCCCTTACAAC

R: GTTTCTTACGGCAGCAGTGAAATCAGA



(GT)x

55

2

135-137

3

(Kerth et al. 2002)

TT20

F: 6-FAM-TCTTACCTCTTTTCCTGC

R: GTTTCTTTTTTTTTCTTCTGTGTTACC



(TG)11

47

6

185-195

3

(Vonhof et al. 2002)
  1   2   3


База данных защищена авторским правом ©shkola.of.by 2016
звярнуцца да адміністрацыі

    Галоўная старонка