Supplementary Figure 1




Дата канвертавання27.04.2016
Памер151.85 Kb.

Yamamoto et al., Particle size distributions and seasonal

diversity of allergenic and pathogenic fungi in outdoor air





Supplementary Figure 1 Rarefaction curves of observed fungal OTUs by particle aerodynamic diameter (da) and season. OTUs are based on 97% similarity.


Supplementary Figure 2 Relative abundances of allergenic and infectious pathogenic fungal species by season. The allergenic (in red) and pathogenic (underlined) species are defined as those listed in Supplementary Tables 3 and 4, respectively.


Supplementary Figure 3 Relative abundances of known allergenic and pathogenic species in each major fungal genus. The abundances are averaged over all particle sizes and seasons. The allergenic (in red) and infectious pathogenic (underlined) species are defined based on the lists of allergenic and pathogenic fungi in Supplementary Tables 3 and 4, respectively.

Supplemental Table 1 Summary statistics of meteorological conditions










Spring

Summer

Fall

Winter

Sampling period

Start

15:30

May 13, 2009



10:45

Aug 11, 2009



11:00

Oct 15, 2009



11:00

Jan 14, 2010






End

10:30

Jun 10, 2009



10:30

Sep 8, 2009



11:00

Nov 12, 2009



10:30

Feb 11, 2010



Temperature (C°) a

Mean

16

23

10

0




Max. of daily average

21

28

17

8




Min. of daily average

12

17

4

-9




Max. of hourly average

28

32

21

13




Min. of hourly average

5

12

-3

-13

Relative humidity (%) a

Mean

72

75

74

63




Max. of daily average

95

89

92

93




Min. of daily average

47

59

48

39




Max. of hourly average

100

97

100

100




Min. of hourly average

24

37

36

24

Wind velocity (m/sec) a

Mean

2.4

2.2

3.2

3.3




Max. of daily average

4.0

4.6

7.0

7.0




Min. of daily average

1.0

0.8

0.2

0.9




Max. of 5 second speed

14.3

11.6

16.1

24.1




Max. of 2 minute speed

10.7

9.4

12.5

17.0

Precipitation (mm/day) a

Mean

3.59

1.09

4.17

1.51

a The original data were obtained from the National Climatic Data Center of the National Oceanic and Atmospheric Administration (http://www.ncdc.noaa.gov/oa/ncdc.html). The data obtained at the Tweed New Haven Airport Station (41°15'50"N 72°53'12"W) were used.

Supplemental Table 2 Sequences of primers and probes used for qPCR assays


Assay name

Fungal species

Primer (probe) name

Sequence 5’-3’

Method

Aaltr a

Alternaria alternata

AaltrF1

GGCGGGCTGGAACCTC

TaqMan




AltrR1-1

GCAATTACAAAAGGTTTATGTTTGTCGTA







AaltrP1

TTACAGCCTTGCTGAATTATTCACCCTTGTCTTT




Afumi a

Aspergillus fumigatus,

Neosartorya fischeri

AfumiF1

GCCCGCCGTTTCGAC

TaqMan




AfumiR1

CCGTTGTTGAAAGTTTTAACTGATTAC







AfumiP1

CCCGCCGAAGACCCCAACATG




Cclad2 a

Cladosporium cladosporioides, svar. 2

Cclad2F1

TACAAGTGACCCCGGCTACG

TaqMan




CcladR1

CCCCGGAGGCAACAGAG







CcladP1

CCGGGATGTTCATAACCCTTTGTTGTCC




Enigr a

Epicoccum nigrum

EnigrF1

TTGTAGACTTCGGTCTGCTACCTCTT

TaqMan




EnigrR1

TGCAACTGCAAAGGGTTTGAAT







EnigrP1

CATGTCTTTTGAGTACCTTCGTTTCCTCGGC




PenGrp3 a

Penicillium chrysogenum / griseofulvum / glandicola /coprophilum /expansum

and Eupenicillium



PchryF1

CGGGCCCGCCTTAAC

TaqMan




PchryR1-1

GAAAGTTTTAAATAATTTATATTTTCACTCAGAGTA







PenP2

CGCGCCCGCCGAAGACA




PenAsp1mgb a

Universal Penicillium, Aspergillus

and Paecilomyces varioti



PenAspF1

CGGAAGGATCATTACTGAGTG

TaqMan




PenAspR1

GCCCGCCGAAGCAAC







PenAspP1mgb

CCAACCTCCCACCCGTG




ITS1F/ITS4 b

Universal fungi

ITS1F

Adaptor A-Key-MID-CTTGGTCATTTAGAGGAAGTAA

Pyrosequencing







ITS4

Adaptor B-Key-TCCTCCGCTTATTGATATGC




a Haugland and Vesper (2002).

b Larena et al. (1999); Manter and Vivanco, (2007).

Supplemental Table 3 List of allergenic fungi (Simon-Nobbe et al., 2008)


Allergenic fungi







Ascomycota

Alternaria porri

Penicillium chrysogenum

Alternaria alternata

Alternaria pseudorostrata

Penicillium notatum

Alternaria argyranthemi

Alternaria radicina

Penicillium citrinum

Alternaria brassicicola

Alternaria solani

Penicillium oxalicum

Alternaria blumeae

Alternaria smyrnii

Pleospora herbarum

Alternaria brassicae

Alternaria sonchi

Stemphylium botryosum

Alternaria capsici

Alternaria tagetica

Saccharomyces cerevisiae

Alternaria carotiincultae

Alternaria tenuissima

Stachybotrys chartarum

Alternaria cetera

Aspergillus flavus

Stemphylium callistephi

Alternaria cheiranthi

Aspergillus fumigatus

Stemphylium vesicarium

Alternaria cinerariae

Aspergillus nidulans

Thermomyces lanuginosus

Alternaria conjuncta

Aspergillus niger

Trichophyton mentagrophytes

Alternaria crassa

Aspergillus oryzae

Trichophyton rubrum

Alternaria cucumerina

Beauveria bassiana

Trichophyton schoenleinii

Alternaria dauci

Candida albicans

Trichophyton tonsurans

Alternaria dumosa

Candida boidinii

Ulocladium alternariae

Alternaria eryngii

Cladosporium herbarum

Ulocladium atrum

Alternaria ethzedia

Cladosporium cladosporioides

Ulocladium botrytis

Alternaria euphorbiicola

Curvularia lunata

Ulocladium chartarum

Alternaria japonica

Embellisia allii

Ulocladium cucurbitae

Alternaria limoniasperae

Embellisia indefessa




Alternaria longipes

Embellisia novae-zelandiae

Basidiomycota

Alternaria macrospora

Embellisia telluster

Coprinus comatus

Alternaria metachromatica

Epicoccum purpurascens

Malassezia furfur

Alternaria mimicula

Epicoccum nigrum

Malassezia sympodialis

Alternaria mouchaccae

Fusarium culmorum

Psilocybe cubensis

Alternaria oregonensis

Fusarium solani

Rhodotorula mucilaginosa

Alternaria petroselini

Nimbya caricis




Alternaria photistica

Penicillium brevicompactum




Supplemental Table 4 List of pathogenic fungi (Makimura, 2001)




Pathogenic fungi a







Ascomycota

Issatschenkia orientalis

Cryptococcus neoformans

Ajellomyces capsulatus

Madurella grisae

Filobasidiella neoformans

Ajellomyces dermatitidis

Microsporum canis

Schizophyllum commune

Arthroderma benhamiae

Microsporum fulvum

Trichosporon asahii

Arthroderma fulvum

Microsporum gypseum

Trichosporon cutaneum

Arthroderma gypseum

Nectria haematococca

Trichosporon inkin

Arthroderma incurvatum

Paecilomyces variotii

Trichosporon mucoides

Arthroderma otae

Paracoccidioides brasiliensis




Arthroderma vanbreuseghemii

Penicillium marneffei

Zygomycota

Aspergillus flavus

Pichia anomala

Absidia corymbifera

Aspergillus fumigatus

Pichia guilliermondii

Cunninghamella sp.

Aspergillus niger

Pneumocystis carinii

Mucor circinelloides

Blastomyces dermatitidis

Pseudallescheria boydii

Rhizopus oryzae

Candida albicans

Scedosporium apiospermum




Candida glabrata

Sporothrix schenckii




Candida guilliermondii

Trichophyton mentagrophytes




Candida krusei

Trichophyton rubrum




Candida parapsilosis

Trichophyton verrucosum




Candida tropicalis

Trichophyton violaceum




Candida pelliculosa







Cladophialophora carrionii

Basidiomycota




Coccidioides immitis

Malassezia furfur




Epidermophyton floccosum

Malassezia globosa




Exophiala dermatitidis

Malassezia obtusa




Fonsecaea pedrosoi

Malassezia pachydermatis




Fusarium solani

Malassezia restricta




Geotrichum candidum

Malassezia slooffiae




Histoplasma capsulatum

Malassezia sympodialis




Hortaea werneckii

Rhodotorula rubra




a The fungal species are selected from the Alphabetical List of Pathogenic Fungi ver.1.2.7. in Pathogenic Fungi Database ver. 1.9.6.1 (http://timm.main.teikyo-u.ac.jp/pfdb/cover/alphabetical_list.html).


Supplemental Table 5 Summary statistics of fungi ITS sequences


Season

Aerodynamic diameter, da (μm)

Number of sequences

Number of sequences determined to each taxonomic level (no. of taxa identified)

Phylum

Class a

Order a

Genus

Species

Spring

>9.0

831

824 (2)

724 (11)

658 (34)

556 (119)

476 (145)




5.8-9.0

766

766 (2)

718 (11)

698 (29)

584 (105)

542 (144)




4.7-5.8

739

737 (2)

696 (11)

676 (28)

610 (100)

576 (132)




3.3-4.7

677

677 (2)

662 (7)

595 (21)

547 (81)

510 (102)




2.1-3.3

433

433 (2)

420 (7)

351 (15)

319 (64)

296 (80)

Summer

>9.0

664

664 (2)

658 (9)

651 (20)

588 (54)

535 (68)




5.8-9.0

918

918 (2)

906 (13)

881 (34)

737 (149)

633 (186)




4.7-5.8

955

948 (2)

934 (12)

916 (32)

780 (151)

689 (203)




3.3-4.7

518

517 (2)

515 (8)

494 (22)

423 (106)

372 (137)




2.1-3.3

315

315 (2)

314 (8)

291 (17)

268 (79)

237 (99)

Fall

>9.0

875

874 (2)

840 (10)

712 (27)

661 (100)

522 (127)




5.8-9.0

749

739 (2)

703 (10)

655 (32)

587 (142)

465 (201)




4.7-5.8

501

500 (2)

485 (10)

475 (28)

439 (121)

384 (168)




3.3-4.7

777

774 (2)

762 (11)

751 (26)

729 (124)

627 (180)




2.1-3.3

311

310 (2)

309 (7)

299 (15)

294 (56)

280 (64)

Winter

>9.0

487

482 (2)

454 (10)

423 (34)

363 (101)

306 (138)




5.8-9.0

916

914 (2)

817 (10)

802 (35)

764 (130)

665 (174)




4.7-5.8

2062

2062(2)

1983 (12)

1970 (26)

1895 (68)

1593 (90)




3.3-4.7

893

893 (2)

885 (8)

866 (26)

837 (76)

742 (101)




2.1-3.3

939

938 (2)

935 (9)

897 (19)

883 (63)

830 (77)

Total

-

15326

15285 (2)

14720 (19)

14061 (68)

12864 (558)

11280 (1172)

a Fungi that are categorized as incertae sedis at these taxonomic levels are excluded from counting the numbers of identified taxa.

Supplemental Table 7 Diversity parameters for sampled atmospheric fungi based on 97% OTU similarity


Season

Aerodynamic diameter, da (μm)

Number of observed OTUs

Chao1

Shannon index

Spring

> 9.0

336

2387

6.7




5.8-9.0

300

1686

7.4




4.7-5.8

368

1983

7.6




3.3-4.7

374

1942

7.7




2.1-3.3

173

908

6.7

Summer

> 9.0

203

746

6.0




5.8-9.0

385

2482

6.9




4.7-5.8

544

4273

8.0




3.3-4.7

268

2662

7.0




2.1-3.3

194

2044

7.1

Fall

> 9.0

256

5157

5.2




5.8-9.0

359

3320

6.8




4.7-5.8

280

1650

7.4




3.3-4.7

545

3579

8.7




2.1-3.3

195

1010

7.4

Winter

> 9.0

185

892

6.8




5.8-9.0

418

1563

7.7




4.7-5.8

350

808

6.0




3.3-4.7

283

1086

7.1




2.1-3.3

358

1117

7.5


Supplementary References
Haugland R, Vesper S (2002). Method of identifying and quantifying specific fungi and bacteria. U.S. Environmental Protection Agency: USA.

Larena I, Salazar O, Gonzalez V, Julian MC, Rubio V (1999). Design of a primer for ribosomal DNA internal transcribed spacer with enhanced specificity for ascomycetes. J Biotechnol 75: 187-194.

Makimura K (2001). Alphabetical List of Pathogenic Fungi Ver.1.2.7. Pathogenic Fungi Database (PFDB) Ver. 1.9.6.1.

Manter DK, Vivanco JM (2007). Use of the ITS primers, ITS1F and ITS4, to characterize fungal abundance and diversity in mixed-template samples by qPCR and length heterogeneity analysis. J Microbiol Meth 71: 7-14.



Simon-Nobbe B, Denk U, Poll V, Rid R, Breitenbach M (2008). The spectrum of fungal allergy. Int Arch Allergy Immunol 145: 58-86.

S



База данных защищена авторским правом ©shkola.of.by 2016
звярнуцца да адміністрацыі

    Галоўная старонка