Supplementary Data Supplemental Materials and Methods Plant material, growth conditions and am inoculation




Дата канвертавання22.04.2016
Памер29.62 Kb.
Supplementary Data
Supplemental Materials and Methods
Plant material, growth conditions and AM inoculation

Depending on the experimental approach, Medicago truncatula was grown under three experimental conditions (Figure 1 A, B, C).


Hairy roots: Targeted inoculation

In order to collect root fragments that were contacted by the fungus during hyphopodium/PPA formation, Agrobacterium rhizogenes-transformed root cultures expressing the GFP-HDEL construct (see below) were derived from both wild-type Medicago truncatula ‘Jemalong’ A17 and the dmi3-1 line (TRV25; Sagan et al., 1998), which is mutated in the gene DMI3 coding for a CCaMK. The GFP-HDEL construct, in which the GFP sequence is conjugated to a signal peptide and the tetra-peptide HDEL, is expressed via the cauliflower mosaic virus 35S promoter and the fusion protein specifically labels the ER (Haseloff et al., 1997). The AM fungus used for targeted AM inoculation was Gigaspora margarita BEG 34. Gi. margarita spores were collected from pot cultures of mycorrhizal Trifolium repens, vernalized at 4°C for 2 weeks, and surface sterilized with 3% (w/v) chloramine T and 10.03% (w/v) streptomycin. Spores were then placed on M medium in petri dishes and cultured at 30°C to induce germination. For the AM inoculation, germinated spores were placed in Petri dishes with fresh root cultures described in Siciliano et al. (2007). All root cultures grew in vertically-oriented Petri dishes to facilitate the development of a regular fishbone-shaped root system (Chabaud et al., 2002) and were incubated at 26°C. For each plate 8 spores were inoculated, positioning them between the lateral roots in order to promote the root-fungus contact. Root and hyphal growth was followed daily under a stereomicroscope. Gi. margarita spores germinated in 2 to 4 days; after inoculation, germ tubes grew upwards and branched, contacting root epidermis. Hyphopodia were generally observed after 5-6 days.


Whole plants: Sandwiches

To get fully mycorrhizal plants, M. truncatula (‘Jemalong’ A17 and mutant dmi3-1) seeds were scarified and surface sterilized for 3 min in sodium hypochlorite. After washing three times with sterile water, the seeds were germinated on water agar in Petri dishes. Mycorrhization was performed by inoculation with Gi. margarita by a modified millipore sandwich method (Giovannetti et al., 1993). One seedling was placed between two nitrocellulose membranes (pore diameter 0.45 μm; Sartorius, Goettingen, Germany), either with 10–15 fungal spores or without any spores. The assembled sandwiches were inserted into Magenta GA-7 filter-lid vessels (Sigma Aldrich, St. Louis, MO, USA). The vessels were filled with sterile acid-washed quartz sand and then soaked up with half-strength Long-Ashton nutrient solution (Hewitt, 1966). Plants were grown in a climatic chamber at 20°C, 60% humidity, with 14 h of light per day. 28 dpi, root samples were harvested under a stereomicroscope.


Treatment with fungal exudate

To investigate the effects of fungal exudates Gi. margarita spores were sterilized and vernalized; then, to induce germination, 100 spores were placed in 1 ml of sterile water and incubated at 30°C in the dark for at least 5 days. The medium was then collected and the fungal exudate concentrated to one tenth of the initial volume by freeze-drying as described in Chabaud et al. (2011). We refer to the resulting solution as the fungal exudates and it was utilized to test plant response to the fungal signal. Three seedlings (obtained as described above - whole plants -) were placed into a 1.5 ml tube containing 1ml of fungal exudates and incubated at 30°C. Roots were collected at 5, 12 and 24 hours after incubation and RNA was extracted. The same experiments were carried out with only sterile water as control.

The Authors thank David Barker (INRA/CNRS, Castanet Tolosan, France) for the mutant lines of M. truncatula and Mara Novero (Life Science and Systems Biology Department, UniTo) for preparing drawings of Figure 1.
RNA isolation

Epidermal cells from GFP-HDEL transformed roots reacted to the fungal contact allowing a focused collection of the root segments (Siciliano et al., 2007). Root segments were immediately frozen in liquid nitrogen in a 2 ml reaction tube. Plant material was then ground using a Retsch® mixer mill for 2 min. RNA was then extracted using the total RNA isolation system (Promega). Integrity of RNA samples was checked using a Biorad Experion Bioanalyzer, while RNA purity was determined by NanoDrop, ensuring spectrophotometric ratios of A260nm/A280nm ~ 2 and A260nm/A230nm ≥ 2. Removal of genomic DNA was performed using the Turbo DNA-free™ reagent (Ambion, Austin, TX, USA) following the manufacturer’s instructions. Absence of genomic DNA was verified by RT-PCR using a One-step kit (Qiagen) with specific primer for elongation factor MtTefa-f (AAGCTAGGAGGTATTGACAAG) and MtTefa-r (ACTGTGCAGTAGTACTTGGTG) (Vieweg et al., 2005).



Medicago GeneChip hybridizations

RNA was processed for use on Affymetrix (Santa Clara, CA, USA) GeneChip Medicago Genome Arrays, according to the manufacturer’s GeneChip 3’ IVT Express kit manual. Briefly, 100 ng of total RNA containing spiked-in poly-A+ RNA controls was used in a reverse transcription reaction (GeneChip 3’ IVT Express Kit; Affymetrix, Santa Clara, CA, USA) to generate first-strand cDNA. After second-strand synthesis, double-stranded cDNA was used in a 16 h in vitro transcription (IVT) reaction to generate aRNA (GeneChip 3’ IVT Express Kit; Affymetrix, Santa Clara, CA, USA). Size distribution of the aRNA and fragmented aRNA, respectively, was assessed via an RNA 6000 Nano Assay on the Agilent 2100 Bioanalyzer (Agilent, Böblingen, Germany). 12.5 µg of fragmented aRNA were used in a 250 µl hybridization cocktail containing added controls. 200 µl of the mixture was hybridized on GeneChips for 16 h at 45°C. Standard post hybridization wash and double-stain protocols (FS450_0001; GeneChip HWS kit; Affymetrix, Santa Clara, CA, USA) were performed on an Affymetrix GeneChip Fluidics Station 450. GeneChips were scanned on an Affymetrix GeneChip scanner 3000 7G. GeneChip data are available from the Gene Expression Omnibus (accession number GSE4617).


Evaluation of GeneChip hybridization data

Original cel files were evaluated using the Robin software (Lohse et al., 2010), using log2-transformation, RMA (Robust Multichip Average) normalization, and statistical tests implemented in Robin. Original probe annotations were replaced by automated annotations and functional classifications generated via the SAMS software (Bekel et al., 2009). Venn diagrams were generated using the Venny software (Oliveros, 2007).

Comparisons of the gene expression data reported here to the core set of genes activated in M. truncatula AM roots at 28dpi with Glomus intraradices and Glomus mosseae (Hogekamp et al., 2011) were performed to identify genes being primarily related to early AM contact stages and being preferentially involved in gibberellin metabolism.
cDNA synthesis and real time RT-PCR

Specific primers for 7 genes activated during the contact stage were designed and Real-time RT-PCR experiments were performed on the following samples: i) GFP-HDEL root segments from the targeted inoculation (early stage); ii) GFP-HDEL non-inoculated transformed roots (early stage); iii) mycorrhizal roots from the sandwiches (28 dpi); iv) roots after treatments with fungal exudates or water (Figure 1 A, B, C).



Real-time PCR experiments were carried out in a final volume of 20 μL containing 10 μL of 5X SYBR Green Reaction Mix (Bio-Rad Laboratories, Hercules, CA), 2μl of 0.2 μM primers, and 1 μL of diluted cDNA (1:3). The following PCR programme was used: 10 min at 95°C, 50 cycles of 15 s at 95°C, 1 min at 60°C. A melting curve (from 60°C to 94°C with a heating rate of 0.5°C every 15 s and a continuous fluorescence measurement) was recorded at the end of every run to exclude primers generating non-specific PCR products (Ririe et al., 1997). All reactions were performed for two biological and three technical replicates. Baseline range and CT values were automatically calculated using the iCycler software. In order to compare data from different PCR runs or cDNA samples, CT values of all genes were normalized to the CT value of MtTEF gene. The 2-ΔΔCt method (Kenneth and Schmittgen, 2001) was used to calculate the relative expression levels. Primer pairs used for the target genes are shown in Supplemental Table 3.
Supplementary References
Bekel, T., Henckel, K., Küster, H., Meyer, F., Mittard Runte, V., Neuweger, H., Paarmann, D., Rupp, O., Zakrzewski, M., Pühler, A., Stoye, J., Goesmann, A. (2009). The Sequence Analysis and Management System SAMS-2.0: data management and sequence analysis adapted to changing requirements from traditional Sanger sequencing to ultrafast sequencing technologies. J. Biotechnol. 140, 3-12.

Chabaud, M., Venard, C., Defaux-Petras, A., Bécard, G., Barker, D.G. (2002). Targeted inoculation of Medicago truncatula in vitro root coltures reveals MtENOD11 expression during early stages of infection by arbuscular mycorrhizal fungi. New Phytol. 156, 265-273.

Chabaud, M., Genre, A., Sieberer, B.J., Faccio, A., Fournier, J., Novero, M., Barker, D.J., Bonfante, P. (2011). Arbuscular mycorrhizal hyphopodia and germinated spore exudates trigger Ca 2+ spiking in the legume and non legume root epidermis. New Phytol 189, 347-355.

Giovanetti, M., Avio, L., Sbrana, C., Citernesi, A.S. (1993). Factors affecting appressorium development in the vesicular-arbuscular mycorrhizal fungus Glomus mossae. New Phytol. 123, 115-122.

Haseloff, J., Siemering, R.K., Prasher, D.C., Hodge, S. (1997). Removal of a cryptic intron and subcellular localization of green fluorescent protein are required to mark transgenic Arabidopsis plants brightly. Proc. Natl. Acad. Sci. 94, 2122-2127.

Hewitt, E.J. (1966). Sand and Water Culture Methods Used in the Study of Plant Nutrition, 2nd Edition. Commonwealth Agricultural Bureaux, Farnham Royal.

Kenneth, J., Schmittgen, D. (2001). Analysis of relative gene expression data using real-time quantitative PCR and the 2-ΔΔCt method. Methods. 25, 402-408.

Hogekamp, C., Arndt, D., Pereira, P.A., Becker, J.D., Hohnjec, N., Küster, H. (2011). Laser-microdissection unravels cell-type specific transcription in arbuscular mycorrhizal roots, including CAAT-box TF gene expression correlating with fungal contact and spread. Plant Physiol. 157, 2023-2043.

Lohse, M., Nunes-Nesi, A., Krueger, P., Nagel, A., Hannemann, J., Giorgi, F.M.,Childs, L., Osorio, S., Walther, D., Selbig, J., Sreenivasulu, N., Stitt, M., Fernie, A.R., Usadel, B. (2010). Robin: An intuitive wizard application for R-based expression microarray quality assessment and analysis. Plant Physiol. 153: 642-51.

Oliveros, J.C. (2007). VENNY: An interactive tool for comparing lists with Venn diagrams. http://bioinfogp.cnb.csic.es/tools/venny/index.html

Ririe, K.M., Rasmussen, R.P., Wittwer, C.T. (1997). Product differentiation by analysis of DNA melting curves during the polymerase chain reaction. Anal Biochem. 245, 154-160.

Sagan, M., de Larambergue, H., Morandi, D. (1998). Genetic analysis of symbiosis mutants in Medicago truncatula. In Biological Nitrogen Fixation for the 21st Century., Elmerich C, Kondorosi A, Newton WE, editors. (Dordrecht: Kluwer Academic Publishers), pp 317-318.

Siciliano, V., Genre, A., Balestrini, R., Cappellazzo, G., DeWitt, P., Bonfante, P. (2007). Transcriptome analysis of arbuscular mycorrhizal roots during development of the prepenetration apparatus. Plant Physiol. 144, 1455-1466.

Vieweg, M.F., Hohnjec, N., Küster, H. (2005). Two genes encoding different truncated hemoglobins are regulated during root nodule and arbuscular mycorrhiza symbioses of Medicago truncatula. Planta 220, 757-766.

Weidmann, S., Sanchez, L., Descombin, J., Chatagnier, O., Gianinazzi, S., Gianinazzi-Pearson, V. (2004). Fungal elicitation of signal transduction- related plant genes precedes mycorrhiza establishment and requires the dmi3 gene in Medicago truncatula. Mol Plant Microbe Interact. 17: 1385–1393.
Legends for Supplementary Materials

Supplementary Figure 1. Functional categories of Medicago truncatula genes activated (A) in WT roots only and (B) in both WT and MtDMi3 roots after the contact with Gi. margarita. When the 90 genes activated in the early AM stages of the wild type but not in the dmi3-1 roots were compared with the 15 genes detected as differentially expressed in the early AM stages by subtractive hybridization (Siciliano et al., 2007), and with the 11 genes reported by Weidmann et al. (2004) as being specific of the hyphopodium phase, only a limited overlap was found. The different experimental approaches that were used and the different coverage of the M. truncatula transcriptome by the tools used most likely explain the limited congruence between the three studies.

Supplementary Figure 2. Real-time RT-PCR measurements of four gibberellin-related genes in WT M. truncatula seedlings after AM fungal exudate treatment for 5, 12 and 24 hours. Different letters indicate significant differences at the 95% level as determined  by the Kruskal-Wallis test (P < 0.05). Relative expression values were calculated by 2-ΔΔCt method (Kenneth and Schmittgen, 2001) and are displayed as mean values of two independent experiments. Material derived from two RNA replicates: one from the array experiment, and another from a new sample, collected from inoculated and non-inoculated WT roots and from MtDmi3 at the early contact stage. Two of the three genes involved in gibberellin synthesis responded slightly to the treatment: while GA2ox7 transcripts increased along the time course, GA3ox1 seemed to be expressed later, and only responded after 12 hours. The ent-kaurenoic acid oxidase 2-like gene did not show any regulation (not shown). Similarly, GID1L2 and the Scarecrow-like transcription factor did not respond in a significant way (not shown) to the treatment, while the DELLA protein GAI and GID1L3 revealed an up-regulation, although their patterns were different. GID1L3 showed a fast activation (5 hours) and its transcript abundance remained significantly high for the first time course points, while the DELLA protein GAI transcripts peaked after 24 hours.
Supplementary Figure 3. Real-time RT-PCR measurements of four gibberellin-related genes in WT M. truncatula seedlings investigated in three phases of plant development: in the absence of the fungus (Control), at the contact with the fungal hyphopodium (Stage 1), and  after 28 days when a full colonization is established (see Fig.1B). Relative expression values were calculated by 2-ΔΔCt method (Kenneth and Schmittgen, 2001) and are displayed as mean values of two independent experiments. Different letters indicate significant differences at the 95% level as determined  by the Kruskal-Wallis test (P < 0.05).
Supplementary Table 1. Gene expression in M. truncatula WT and MtDMI3 roots in response to contact with Gi. margarita.

Supplementary Table 2. M. truncatula genes activated in WT and DMI3 roots in response to contact with Gi. margarita. The individual sheets contain selected subsets of genes as explained in the Supplemental file.

Supplementary Table 3. List of primers used for the gene expression analysis in qReal-time RT-PCR.
Acknowledgements

Research in PB lab was funded by the Project Converging Technologies –BIOBIT and in JDB lab by Project PTDC/AGR–GPL/70592/2006 from Fundação para a Ciência e a Tecnologia, Portugal.








База данных защищена авторским правом ©shkola.of.by 2016
звярнуцца да адміністрацыі

    Галоўная старонка