MG336 é uma sequencia codificadora identificada no genoma de Mycoplasma genitalium




Дата канвертавання22.04.2016
Памер22.79 Kb.
Exercício


  1. MG336 é uma sequencia codificadora identificada no genoma de Mycoplasma genitalium pelo institudo TIGR (http://www.tigr.org/index.shtml). Qual é o tamanho desse gene? Qual a sua posição no genoma de M. genitalium? Se você usar o Entrez (http://www.ncbi.nlm.nih.gov/Entrez/index.html), poderá encontrá-lo. Qual a função desse gene? Que proteína esse gene codifica? Consulte outros bancos de dados para obter mais informações sobre esse gene e a proteína a qual ele codifica.




  1. Um paciente jovem desmaiou durante uma jornada de mountain-climbing. Você isolou a seguinte seqüência do tecido do seu paciente:

agctcctgct tagggcatgt aggagacctg gtcagcagca tctccatctt tctgcagctt gaccctcaac accaaccatg ggcatatcct ggtggattac tccaagaacc tggtgacgga

ggacgtgatg cggatgctgg tggacttggt aatgttctgc ttggggaggc ataactggta

accgacagag tggtgggtga gctgggctct gggagtccca ggaccttgag tatcttgagt

tcttcctctc attagacctc agtcacctcc tctgtgctgg tgaggcacct gtccctggct

taggttctaa gcagcatccc agggacccca gtgtctgatg tctgagtaga cccttcccag

acagcagggg agggaaccga gcagcagccg tctgtctgtc tcattgggga cagcaccaag

ccttgtgttt gggggctgac acttggggtg gccagtgtgg gtgggaccag gcctcagtat

cgtctcttcc taggccaagt ccaggg

a) Qual é o nome, substrato e produto da enzima?
b) Em qual cromossomo esse gene está localizado?
c) De qual doença esse paciente pode estar sofrendo?
3

) O último lobo da Tasmânia (Thylacinus cynocephalus) conhecido morreu no Hobart Zoo em 1936. Seqüências de DNA foram obtidas de espécimes de museus. (Realmente há um esforço em se clonar esse animal utilizando material de museu). Você pode recuperar seqüências de lobo tasmaniano usando o “Taxonomy Browser” (http://www.ncbi.nlm.nih.gov/sites/entrez?db=taxonomy). Procure a base de dados do Tigre da Tasmânia. Quantas seqüências de DNA e proteínas existem? Você pode construir um  grupo de dados filogenéticos que poderia ser utilizado para analisar a posição taxonômica do Lobo da Tasmânia com o “Taxonomy Browser”. Acesse a linhagem do tigre clicando no link “Metatheria” (Marsupial). Quantas seqüências nucleotídeas existem para Metatheria? Recupere a entrada para “Metatheria” e pegue as seqüências nucleotídicas. Em “Entrez” você pode refinar a busca incluindo somente seqüências de citocromo b através do “Preview/Index”. Quantas seqüências de citocromo b de marsupiais existem? Você poderá salvar tais seqüências em formato FASTA para serem usadas em análises filogenéticas se você quiser. Você poderá investigar ainda mais a linhagem para conseguir uma seqüência de um grupo externo. Há muitas seqüências de organismos extintos nas bases de dados do NCBI. Visite a lista de Táxons extintos (http://www.ncbi.nlm.nih.gov/Taxonomy/taxonomyhome.html/index.cgi?chapter=extinct) nas páginas de taxonomia. Você acredita ser possível recriar uma espécie extinta a partir de fragmentos de seqüência? 
4) A fantasia de Michael Crichton sobre a clonagem de dinossauros, o livro Jurassic Park, contém uma seqüência provável de dinossauro. Use o BLASTn contra a base de dados de nucleotídeos “nr” para identificar a verdadeira fonte da seguinte seqüência.
>DinoDNA  "Dinosaur DNA" from Crichton's JURASSIC PARK  p. 103 nt 1-1200

GCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGC

GGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCG

TGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGC

TGCTCACGCTGTACCTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTG

CCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAA

AGTAGGACAGGTGCCGGCAGCGCTCTGGGTCATTTTCGGCGAGGACCGCTTTCGCTGGAG

ATCGGCCTGTCGCTTGCGGTATTCGGAATCTTGCACGCCCTCGCTCAAGCCTTCGTCACT

CCAAACGTTTCGGCGAGAAGCAGGCCATTATCGCCGGCATGGCGGCCGACGCGCTGGGCT

GGCGTTCGCGACGCGAGGCTGGATGGCCTTCCCCATTATGATTCTTCTCGCTTCCGGCGG

CCCGCGTTGCAGGCCATGCTGTCCAGGCAGGTAGATGACGACCATCAGGGACAGCTTCAA

CGGCTCTTACCAGCCTAACTTCGATCACTGGACCGCTGATCGTCACGGCGATTTATGCCG

CACATGGACGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAA

CAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAA

GCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGG

CTTTCTCAATGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTG

ACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCA

ACACGACTTAACGGGTTGGCATGGATTGTAGGCGCCGCCCTATACCTTGTCTGCCTCCCC

GCGGTGCATGGAGCCGGGCCACCTCGACCTGAATGGAAGCCGGCGGCACCTCGCTAACGG

CCAAGAATTGGAGCCAATCAATTCTTGCGGAGAACTGTGAATGCGCAAACCAACCCTTGG

CCATCGCGTCCGCCATCTCCAGCAGCCGCACGCGGCGCATCTCGGGCAGCGTTGGGTCCT
Mark Boguski do NCBI percebeu que essa seqüência não era tão adequada e forneceu a Crichton uma seqüência melhor, mostrada abaixo, para a continuação da história no livro “The Lost World”. Identifique a fonte mais provável desta seqüência usando o BLASTn. Mark encaixou seu nome na seqüência que ele forneceu. Para ver o nome de Mark use o BLASTx. (Procure por MARK WAS HERE e mais um nome conhecido, qual é?).
>DinoDNA "Dinosaur DNA" from Crichton's THE LOST WORLD p. 135
GAATTCCGGAAGCGAGCAAGAGATAAGTCCTGGCATCAGATACAGTTGGAGATAAGGACG
GACGTGTGGCAGCTCCCGCAGAGGATTCACTGGAAGTGCATTACCTATCCCATGGGAGCC
ATGGAGTTCGTGGCGCTGGGGGGGCCGGATGCGGGCTCCCCCACTCCGTTCCCTGATGAA
GCCGGAGCCTTCCTGGGGCTGGGGGGGGGCGAGAGGACGGAGGCGGGGGGGCTGCTGGCC
TCCTACCCCCCCTCAGGCCGCGTGTCCCTGGTGCCGTGGGCAGACACGGGTACTTTGGGG
ACCCCCCAGTGGGTGCCGCCCGCCACCCAAATGGAGCCCCCCCACTACCTGGAGCTGCTG
CAACCCCCCCGGGGCAGCCCCCCCCATCCCTCCTCCGGGCCCCTACTGCCACTCAGCAGC
GGGCCCCCACCCTGCGAGGCCCGTGAGTGCGTCATGGCCAGGAAGAACTGCGGAGCGACG
GCAACGCCGCTGTGGCGCCGGGACGGCACCGGGCATTACCTGTGCAACTGGGCCTCAGCC
TGCGGGCTCTACCACCGCCTCAACGGCCAGAACCGCCCGCTCATCCGCCCCAAAAAGCGC
CTGCTGGTGAGTAAGCGCGCAGGCACAGTGTGCAGCCACGAGCGTGAAAACTGCCAGACA
TCCACCACCACTCTGTGGCGTCGCAGCCCCATGGGGGACCCCGTCTGCAACAACATTCAC
GCCTGCGGCCTCTACTACAAACTGCACCAAGTGAACCGCCCCCTCACGATGCGCAAAGAC
GGAATCCAAACCCGAAACCGCAAAGTTTCCTCCAAGGGTAAAAAGCGGCGCCCCCCGGGG
GGGGGAAACCCCTCCGCCACCGCGGGAGGGGGCGCTCCTATGGGGGGAGGGGGGGACCCC
TCTATGCCCCCCCCGCCGCCCCCCCCGGCCGCCGCCCCCCCTCAAAGCGACGCTCTGTAC
GCTCTCGGCCCCGTGGTCCTTTCGGGCCATTTTCTGCCCTTTGGAAACTCCGGAGGGTTT
TTTGGGGGGGGGGCGGGGGGTTACACGGCCCCCCCGGGGCTGAGCCCGCAGATTTAAATA
ATAACTCTGACGTGGGCAAGTGGGCCTTGCTGAGAAGACAGTGTAACATAATAATTTGCA
CCTCGGCAATTGCAGAGGGTCGATCTCCACTTTGGACACAACAGGGCTACTCGGTAGGAC
CAGATAAGCACTTTGCTCCCTGGACTGAAAAAGAAAGGATTTATCTGTTTGCTTCTTGCT
GACAAATCCCTGTGAAAGGTAAAAGTCGGACACAGCAATCGATTATTTCTCGCCTGTGTG
AAATTACTGTGAATATTGTAAATATATATATATATATATATATATCTGTATAGAACAGCC
TCGGAGGCGGCATGGACCCAGCGTAGATCATGCTGGATTTGTACTGCCGGAATTC
5) Genomas de eucariontes pluricelulares contêm uma grande quantidade de DNA repetitivo. A repetição mais comum no genoma humano é o elemento Alu. Eles tendem a ocorrer próximo a genes dentro de íntrons ou em regiões entre genes. Em alguns casos a presença e ausência deles mostram uma acurada estrutura íntron éxon de um gene. Demonstre isso realizando uma busca no BLASTn contra a base de dados de Alu do BLAST com a seqüência genômica humana do gene da síndrome de Von Hippel Landau, cód. de acesso AF010238. Observe que os éxons aparecem no gráfico do BLAST como regiões onde os elementos Alu não alinham.

6) O gene de C. elegans SMA-4 é um membro da família dos genes de nanismo, que exerce um papel na transdução de sinal mediada por TGF. Com o objetivo de identificar homólogos potenciais em outras espécies, use o BLASTp para executar uma busca contra a base de dados de proteínas não redundante (nr) usando a SMA-4 (cód, acesso P45897) como a seqüência “problema”. Encontre todas as proteínas de galinha (Gallus gallus) que sejam similares à SMA-4. (Use o link do “Taxonmy Reports” na parte superior esquerda do gráfico para ajudar a encontrar as proteínas de galinha). Agora execute a pesquisa novamente e restrinja para proteínas de G. gallus através da opção de busca avançada. Que proteínas são encontradas? Compare os valores de expectativa destes resultados aos que foram encontrados contra o “nr” sem a restrição de organismo. Por que os valores de E são diferentes para as mesmas pontuações (scores) e alinhamentos?


7) Vamos pesquisar sobre o gene BRCA1, que é um gene bastante conhecido envolvido no câncer de mama. Esse gene pertence a uma classe de genes conhecida como supressores de tumor. Como muitos outros genes dessa classe, BRCA1 regula o ciclo da divisão células impedindo as células de crescer e se dividirem muito rapidamente e de modo descontrolado.

 

I – Usando o ExPASy Proteomics Server (Swiss-Prot)

- Entre em http://au.expasy.org/sprot

Na caixa de busca no topo da página principal, entre com “BRCA1 HUMAN”.

A busca retorna 13 proteínas relacionadas no Swiss-Prot e 53 entradas no TrEMBL.

Entre as 13 listadas pelo Swiss-Prot, 4 são “associadas” com a BRCA1, 3 “interagem” com a BRCA1 e 2 são “vizinhas” da BRCA1. Somente uma das proteínas listadas é codificada pelo gene BRCA1, a proteína da suscetibilidade a câncer de mama do tipo1.



a) Qual o número de acesso da proteína feita pelo gene BRCA1 humano?

Vamos começar a anotar os dados coletados nessa pesquisa. É interessante datar os resultados (porque os dados no Swiss-Prot são constantemente atualizados). Anote os números de acesso e o nome das proteínas listadas que “interagem” e que se “associam” com a BRCA1.



b) Sugira outro termo de busca para a BRCA1 no Swiss-Prot baseado nos sinônimos conhecidos. Faça uma busca usando o sinônimo. Quantas entradas são obtidas na busca?

Clique no link para a BRCA1 HUMAN. Em “Interaction”, dentro da seção “Comments” observe os números de acesso. Comparando esses números com os dados previamente anotados percebe-se que a lista está incompleta.



c) Quais proteínas já estão anotadas? Anote as faltantes.

II – Cross-references no Swiss-Prot

Na seção “Cross References” existem quatro links para visões gráficas da estrutura, o InterPro, Pfam, PROSITE e o ProDom. Navegue por eles.

O InterPro mostra o melhor palpite de quais seriam os principais domínios da proteína no topo da página. Logo embaixo há uma tabela com os diferentes métodos usados pra chegar a essa conclusão.

O Pfam mostra uma figura mais detalhada dos domínios no BRCA1.



d) Quantos domínios conservados existem? Quais são eles?

III – Features no Swiss-Prot

Na seção “Features” há a VARIANT 22 22 (VAR 007756).



e) Por que essa variação é importante? O que varia?

f) Dê um artigo relacionado ao estudo da VARIANT 22 22.


База данных защищена авторским правом ©shkola.of.by 2016
звярнуцца да адміністрацыі

    Галоўная старонка