Line-1 specific zinc fingers




Дата канвертавання20.04.2016
Памер43.54 Kb.

LINE-1 specific zinc fingers


ZF A recognition site: 5´-ACC AAC AGT GTA AAA GTG-3´;

ZF B recognition site: 5´-GCC ATA AAA AAT GAT GAG-3´;

ZF C recognition site: 5´-GGT GGG GTC GGG GGA GGG-3´.

Individual fingers and corresponding binding site are indicated with corresponding ZF DNA recognition helices from amino acid -1 to +6 in brackets:

ZFA: F1-GTG (RSDELVR), F2-AAA (QRANLRA), F3-GTA (QSSSLVR), F4-AGT (HRTTLTN), F5-AAC (DSQNLRV), F6-ACC (DKKDLTR)

ZFB: F1-GAG (RSDNLVR), F2-GAT (TSGNLVR), F3-AAT (TTGNLTV), F4-AAA (QRANLRA), F5-ATA (QKSSLIA), F6-GCC (DCRDLAR)

ZFC: F1-GGG (RSDKLVR), F2-GGA (QRAHLER), F3-GGG (RSDKLVR), F4-GTC (DPGALVR), F5-GGG (RSDKLVR), F6-GGT (TSGHLVR)

ß-galactosidase assay

15 µl of cell extract was incubated with 500 µl ß-galactosidase assay buffer (100 mM HEPES pH 7.3 KOH, 150 mM NaCl, 4.5 mM Aspartate (hemi-Mg salt), 1 % w/v bovine serum albumin, 0.05 % v/v Tween 20, 1.6 mM chlorphenol red- ß-D-galactopyranosid) until colour change. The reaction was then stopped by adding 250 µl 3 mM ZnCl2 and absorbance was measured at 578 nm. ß-galactosidase values were calculated using the following formula: ß-gal units = 1000 x OD578 nm / t x OD595 nm where t is the time of incubation of the ß-galactosidase assay buffer with the sample before addition of ZnCl2. To determine efficiency of cell lysis, protein content was measured using a Bradford assay. 1 ml 1:5 diluted Bio-Rad Protein assay solution (BioRad) was incubated with 10 µl sample. Following short incubation time absorbance was measured at 595 nm.



LAM-PCR for Illumina sequencing

Linear amplification. Linear PCR reactions were done in 20 mM Tris pH 8.4, 50 mM KCl, 1.5 mM MgCl2, 0.2 mM dNTP, 0.02 pM biotinylated primer LAM-SB/L-50Bio, 2.5 U Taq-Polymerase. PCR program: 94 °C 4 min, 50 cycles of 94 °C 40 sec, ramp to 54 °C 1 °C/sec, 54 °C 30 sec, 72 °C 1 min. After one round of linear PCR, an extra 0.5 µl of Taq Polymerase was added and samples were subjected to a second round of linear PCR.

Magnetic capture. Biotinylated linear PCR products were captured by streptavidin coupled beads (Dynabeads kilobaseBINDER Kit, Invitrogen). Upon exposure to a magnet DNA coupled to the beads was separated from supernatant. Magnetic capture was done according to manufacturer´s protocol.

Second strand synthesis. Linear PCR products were converted into dsDNA. The second strand synthesis reaction was performed using 2 µl 10 x Hexanucleotide mix (Roche), 0.25 mM dNTP, 2 U Klenow fragment (Fermentas), x µl H2O in 20 µl on linear DNA coupled to magnetic beads.

End repair. Possible overhangs of dsDNA created by second strand synthesis were blunt-ended and 5´-ends phosphorylated using the End It DNA End-Repair Kit (Epicentre Biotechnologies) according manufacturer´s instructions.

Adding A´-overhangs. A´-overhangs were added to the 3´-ends of DNA molecules. Magnetic beads were incubated in 5 µl NEB2 buffer, 0.2 mM dATP, 1 µl Klenow fragment Exo (-) (New England Biolabs) and 43 µl H2O for 30 min at 37 °C following 20 min at 75 °C for heat inactivation.

Linker ligation. A double stranded sonic linker with T´-overhangs was ligated to DNA coupled to beads using the Fast-Link DNA Ligation Kit (Epicenter Biotechnologies): 1 µl 10x ligation buffer, 1 µl 10 mM ATP, 1 µl Fast-Link ligase, 1 µl 50 pmol/µl sonic linker. Ligation reaction was carried out at 4 °C overnight.

Nested PCR. After ligation DNA plus linker coupled to beads was resuspended in 10 µl TE. 2 µl of bead suspension, 1 µl 10 mM dNTP, 1 µl 10 pmol/µl linker primer, 1 µl 10 pmol/µl LAM SBL-20 hmr, 2.5 U Taq polymerase, 3 µl 25 mM MgCl2, 5 µl 10 x Taq buffer and H2O to fill up the reaction to 50 µl were PCR amplified using the following PCR program: 94 °C 2 min followed by 35 cycles of 94 °C 30 sec, ramp to 55 °C 1 °C/sec, 55 °C 20 sec, 72 °C 30 sec ended by 72 °C 5min. A nested PCR was performed with 1 µl of PCR 1, 1 µl 10 mM dNTP, 1 µl 10 pmol/µl nested primer, 1 µl 10 pmol/µl primer SB III barcode_OVH, 2.5 U Taq polymerase, 3 µl 25 mM MgCl2, 5 µl 10 x Taq buffer and H2O to fill up the reaction to 50 µl were PCR amplified using the following PCR program: 94 °C 3 min followed by 35 cycles of 94 °C 30 sec, ramp to 51 °C 1 °C/sec, 51 °C 20 sec, 72 °C 30 sec ended by 72 °C 5 min. Barcoded primers annealed at the end of the SB transposon. They were identical except for four bases within the primer. All PCR reactions ascribing to one transposase (fused, mixed or unfused) were done with the same barcoded primer, so that transposon integrations mapped from PCR products could be traced back to corresponding transposases. A third PCR was performed to add overhangs necessary for recognition by the Genome Analyzer IIx (Illumina). 1 µl of PCR 2, 1 µl 10 mM dNTP, 1 µl 10 pmol/µl Illumina Pr1, 1 µl 10 pmol/µl Illumina Pr2, 0.5 µl Phusion polymerase, 10 µl Phusion buffer and H2O to fill up the reaction to 50 µl were PCR-amplified using the following PCR program: 98 °C 30 sec followed by 14 cycles of 98 °C 10 sec, 65 °C 30 sec, 72 °C 30 sec ended by 72 °C 5 min. PCR reactions were run on an agarose gel and verified for product sizes ranging from 100 bp to 500 bp. Equal amounts for all samples with differing barcodes were mixed together and loaded to a Genome Analyzer IIx (Illumina) analyzer.

Primer sequences





Primer name

Sequence 5´ 3´

BalRev3

aaagccatgacatcattttctggaatt

BalRev

cttgtcatgaattgtgatacagtgaattataagtg

CAT fw

GGC CTC ACG TAG TGA CCC GAC GCA CTT TGC GCC GAA T

CAT rv

CTG GAT CGA TCC ACC ATA CCC ACG CCG AAA CAA

erbB2/5

CGA TGT GAC TGT CTC CTC CCA AA

erbB2ΔE2C_fw

p-gac agc acc aag ctt ggc att cc

erbB2ΔE2C_rv

p-gac atg gct ccg gct gga ccc gg

fw_NheI/SalI-SB

GCT GCT GCT AGC TGC TGT CGA CGG AAA ATC AAA AGA AAT CAG CCA AGA C

Illumina Pr1

AAT GAT ACG GCG ACC ACC GAG ATC TAC ACT CTT TCC CTA CAC GAC GCT CTT CCG ATC T

Illumina Pr2

CAA GCA GAA GAC GGC ATA CGA GCT CTT CCG ATC T

LAM SBL-20 hmr

ACT TAA GTG TATGTA AAC TTC CGA CT

LAM-SB/L-50Bio

Biotin-AGT TTT AAT GAC TCC AAC TTA AGT G

LAM SBleft II

ACA AAG TAG ATG TCC TAA CTG ACT

LAM-SBleft-Bio

Biotin-TGT AAA CTT CTG ACC CAC TGG AAT TG

Linker primer

GTA ATA CGA CTC ACT ATA GGG C

Nested primer

AGG GCT CCG CTT AAG GGA C

pUC2

GCG AAA GGG GGA TGT GCT GCA AGG

pUC5

TCT TTC CTG CGT TAT CCC CTG ATT C

SB-Not-rv

CTG AAT GCG GCC GCT AGT ATT TGG TAG CAT TGC CTT TAA ATT G

T-Jobb1

tttactcggattaaatgtcaggaattg

T-Jobb2

tgagtttaaatgtatttggctaaggtg

XhoI ohne ATG ZF4 fw

CGG TCT CGA GCT GGA ACC CGG CGA GAA GCC

ZF4 STOP ApaI rv

GTA CCG GGC CCT CAG CTG GTC TTT TTG CCA GTA TGG

19-3F

GTT TTC CCA GTC ACG ACG TT

19-3R

TGT GGA ATT GTG AGC GGA TA

Barcoded primers:

SB III AAAA_OVH

Acactctttccctacacgacgctcttccgatctaaaagtaaacttc

cgacttcaactgta



SB III TACC_OVH

AcactctttccctacacgacgctcttccgatctTACCgtaaacttc

cgacttcaactgta



SB III CCCA_OVH

AcactctttccctacacgacgctcttccgatctCCCAgtaaacttc

cgacttcaactgta



SB III ATGC_OVH

AcactctttccctacacgacgctcttccgatctATGCgtaaacttc

cgacttcaactgta



SB III CGTC_OVH

AcactctttccctacacgacgctcttccgatctCGTCgtaaacttc

cgacttcaactgta



SB III TTTA_OVH

Acactctttccctacacgacgctcttccgatcttttagtaaacttc

cgacttcaactgta



SB III GGGA_OVH

AcactctttccctacacgacgctcttccgatctGGGAgtaaacttc

cgacttcaactgta




Oligonucleotides


Oligonucleotide

name

Sequence 5´ 3´

Linker 1A +

CTA GCG GGC AGC GGA GGG AGC GGC GGA AGT GGG GGC AGC GGC GGA AGT GGC G

Linker 1A -

TC GAC GCC ACT TCC GCC GCT GCC CCC ACT TCC GCC GCT CCC TCC GCT GCC CG

Linker 2A +

CTA GCG GGC ACC AGC AGT GGC GGA AGT GGG AGC AGT GGC AGT GGG GGC AGT G

Linker 2A -

TC GAC ACT GCC CCC ACT GCC ACT GCT CCC ACT TCC GCC ACT GCT GGT GCC CG

Linker 2B +

CTA GCG GGC ACC AGC AGT GGC GGA AGT GGG AGC AGT GGC AGT GGG AGT GGC GGA AGT GGG GGC AGT

Linker 2B -

TC GAC ACT GCC CCC ACT TCC GCC ACT CCC ACT GCC ACT GCT CCC ACT TCC GCC ACT GCT GGT GCC CG

Linker 3A +

CTA GCG CTG GCC GAG GCC GCT GCA AAG GAG GCC GCT GCA AAG GCA GCC GCT G

Linker 3A -

TCG ACA GCG GCT GCC TTT GCA GCG GCC TCC TTT GCA GCG GCC TCG GCC AGC G

Linker 3B +

CTA GCG CTG GCC GAG GCC GCT GCA AAG GAG GCC GCT GCA AAG GAG GCC GCT GCA AAG GCA GCC GCT G

Linker 3B -

TC GAC AGC GGC TGC CTT TGC AGC GGC CTC CTT TGC AGC GGC CTC CTT TGC AGC GGC CTC GGC CAG CG

Linker

(KLGGGAPAVGGGPKAADK)+



GGC ATG CTA GCT AAG CTG GGC GGA GGC GCT CCT GCT GTG GGA GGA GGA CCT AAG GCT GCC GAC AAG GTC GAC ATC GG

Linker

(KLGGGAPAVGGGPKAADK)-



CC GAT GTC GAC CTT GTC GGC AGC CTT AGG TCC TCC TCC CAC AGC AGG AGC GCC TCC GCC CAG CTT AGC TAG CAT GCC

Bfa linker +

GTA ATA CGA CTC ACT ATA GGG CTC CGC TTA AGG GAC

Bfa linker -

p-TAG TCC CTT AAG CGG AG-Amino

Sonic TA link(+)

GTA ATA CGA CTC ACT ATA GGG CTC CGC TTA AGG GAC CAT ACG AGC TCT TCC GAT CT

Sonic Link(-)amino

GAT CGG AAG AGC TCG TAT G-Amino


База данных защищена авторским правом ©shkola.of.by 2016
звярнуцца да адміністрацыі

    Галоўная старонка