Isolation and characterization of 16 polymorphic microsatellite loci for Frangula alnus (Rhamnaceae)




Дата канвертавання19.04.2016
Памер202.1 Kb.




Isolation and characterization of 16 polymorphic microsatellite loci for Frangula alnus (Rhamnaceae)
C. RIGUEIRO, J. M. ARROYO, R. RODR ÍGUEZ, A. HAMPE and P. JORDANO Department of Integrative Ecology, Estación Biológica de Doñana (CSIC), Avenida Américo Vespucio, s/n, 41092 Sevilla, Spain
Abstract
We report the first 16 polymorphic nuclear microsatellite markers developed for Frangula alnus (Rhamnaceae). Markers were tested on all three subspecies as well as on three local populations, including analyses of both leaf and seed endocarps. A total of 87 alleles were found (mean number of alleles per locus was 5.44) for 72 individuals genotyped. Observed and expected heterozygosities ranged from 0.097 to 0.792 and from 0.093 to 0.794, respectively. The levels of polymorphism and exclusionary power of the developed markers render them applicable for parentage analyses and measurements of seed dispersal through direct com- parison of endocarps and adult tree genotypes.
Keywords: endocarp, Frangula, Rhamnaceae, seed dispersal, SSR


Recent advances in seed dispersal studies allow the direct estimation of dispersal distances based on assignment proce- dures that use the genotype of maternally derived seed end- ocarps and the genotype of candidate maternal trees (Godoy
Correspondence: Pedro Jordano, Fax: +34 954621125; E-mail:

jordano@ebd.csic.es

& Jordano 2001). These techniques require reliable sets of microsatellite markers allowing robust exclusion of candidate source trees and applicable to tissues of both seeds and established seedlings.

Frangula alnus Mill. (Rhamnaceae) is a shrub or small tree widely distributed over Europe and West Asia; most of the native range is occupied by Frangula alnus alnus, while F. a.




baetica and F. a. pontica are endemic to the Southwestern

Mediterranean and Anatolia, respectively (Hampe et al.

2003). The species lacks vegetative reproduction and there- fore depends on its animal-dispersed seeds for regeneration. Hence, patterns of seed dispersal may greatly influence spatial patterns of regeneration and the resulting genetic structure. We developed microsatellite markers for F. alnus, since they have been successfully applied to parentage and relatedness testing and would allow genotyping of both leaf and endocarp tissues.

Microsatellite libraries were developed following Jones et al. (2002). Genomic DNA was extracted from leaves of a single tree using the QIAGEN DNeasy Plant Extraction kit. The DNA was partially restricted with seven blunt-end restriction enzymes (RsaI, HaeIII, BsrB1, PvuII, StuI, ScaI and EcoRV). Fragments (300–750 bp) were ligated with 20-bp oligonucleotides containing a HindIII site at the 5′ end, and subjected to magnetic bead capture. Four libraries were pre- pared in parallel using biotin-CA15, biotin-GA15, biotin-ATG12



and biotin-AAC12 as capture molecules (CPG Inc.). Captured

molecules were amplified and restricted with HindIII to remove the adapters. The resulting fragments were ligated into the HindIII site of pUC19 plasmid and introduced into Escherichia coli DH5α by electroporation. Recombinant clones were selected at random for sequencing. Seventy of them contained a microsatellite sequence. Polymerase chain reac- tion (PCR) primer pairs were designed for 36 clones using Designer pcr 1.03 (Research Genetics Inc.).

For primer testing, DNA was isolated from silica-dried

leaves of 72 trees collected in three populations (Aljibe, Medio and Puerto Oscuro; ‘Los Alcornocales’ Natural Park, Cádiz, Spain). We used a standard cetyltrimethyl ammonium bro- mide (CTAB) extraction method (Milligan 1998) with minor modifications tissue grinding in a MM301 Retsch™ mill and TLE resuspension.

PCR was performed in 20 μL final volume containing 1× buffer (67 mm Tris-HCL pH 8.8, 16 mm (NH4)2SO4, 0.01% Tween-20), 2.5 mm MgCl2, 0.01% BSA (Roche Diagnostics),

0.25 mm dNTP, 0.40 μm dye-labelled M13 primer, 0.25 μm

tail-reverse primer, 0.034 μm M13 tailed-forward primer,

0.5 U Taq DNA polymerase (Bioline) and 5 μL of genomic DNA. Samples were incubated in a ‘touchdown’ PCR in a Bio-Rad DNA EngineR. Peltier Thermal Cycler, with an initial 2 min of denaturation at 94 °C; 17 cycles at 92 °C for

30 s, annealing at 60–44 °C for 30 s (1 °C decrease in each cycle), and extension at 72 °C for 30 s; 25 cycles at 92 °C for

30 s, 44 °C for 30 s, and 72 °C for 30 s with final extension for 5 min at 72 °C. Amplified fragments were analysed on an ABI 3130xl Genetic Analyser and sized using Gene- Mapper 4.0 (Applied Biosystems) and LIZ 500 size standard. We also tested DNA isolation and amplification from seed endocarps. For this purpose, seeds were split open and the endocarp was separated by hand from the embryo. We followed the DNA isolation protocol for leaves with two

modifications: after tissue grinding, samples were homo- genized in 400 μL of extraction buffer and the DNA pellet was resuspended in 85 μL TLE. The reaction mix was iden- tical to that described above.

All 36 primer pairs amplified products of appropriate size. Ten were monomorphic or showed complex amplification. Twenty-six were polymorphic, eight of them showing only two alleles and four having a high frequency of null alleles. We finally retained 16 primers after inspecting their observed and expected heterozygosities (Cervus 3.0; Kalinowski et al.

2007) and testing for deviations from Hardy–Weinberg equilibrium, gametic disequilibrium (GenePop 4.0; Rousset

2007) and the presence of null alleles (Micro-Checker 2.2.3; van Oosterhout et al. 2004). We used Bonferroni-corrected P values to assess significance of the results obtained.

Table 1 summarizes the features of the 16 loci reported. We detected a total of 87 alleles (allele numbers per locus:

2–11; mean = 5.44). No locus showed deviations from Hardy– Weinberg equilibrium (P > 0.1 in all three populations). We detected however, some evidence of gametic disequilibrium (Bonferroni-corrected P < 0.05/16 = 0.003) in two primer combinations: FaB7/FaA7 in the Medio population, and FaA116/FaB8 in the Medio and Aljibe populations. The presence of null alleles was confirmed for two loci (Bonferroni corrected P < 0.003): FaA103 in the Aljibe site and FaA8 in Puerto Oscuro. The combined nonexclusion probability across all 72 trees was 0.041 for the first parent and 0.002 for the second parent (0.035–0.144 and 0.002–0.013, respectively, for each population separately). These levels of poly- morphism and the exclusionary power of the markers render them readily applicable for direct measurements of seed dispersal through parent assignment.

Reliable genotypes were obtained from seed endocarps. By comparing the endocarp genotype of seeds collected from known trees with the leaf-derived genotype, we could con- firm the maternal derivation of the endocarp tissue in F. alnus and therefore its suitability for assigning source trees to dispersed seeds (Godoy & Jordano 2001).

We also assessed the transferability of the 16 microsatel- lite loci by analysing material from 10 populations including all three subspecies; four baetica populations from Morocco (Jbel Bouhachem I and II; see Hampe et al. 2003 for population features) and southern Spain (Doñana and Huerta Vieja), five alnus populations (Coruña, Guara, Mondego, Nava del Barco and Pierroton) and one pontica population (Djarnali). Three loci revealed some problems: FaA116 did not amplify in alnus and pontica as well as in one baetica population (Doñana), FaA103 showed deficient amplification for some alnus and pontica samples, and FaB4 failed to amplify for the Guara population (ssp. alnus). The remaining 13 markers worked reliably for all tested populations. We observed a total of

128 new alleles, suggesting that analyses of additional material may result in a further noteworthy increase in polymorphism.




Table 1 Characteristics of 16 polymorphic microsatellite markers isolated from Frangula alnus populations at Aljibe (ALJ), Medio (MED), and Puerto Oscuro (PO) (Cádiz, Spain)

Locus name

(GenBank ID)


Primer sequences (5′–3′)


Repeat motif


Allele size range (bp)




n

ALJ



k

ALJ



HO

ALJ



HE

ALJ

HW ALJ



n

MED



k

MED



HO

MED



HE

MED

HW MED



n

PO



k

PO



HO

PO



HE

PO

HW PO

FaA103 (FJ375935)


F: CCGGATGTCCGAATAGTAG

R: GTCAGCGATTATAGCAATATCC

(AC)27


115–141

30

7

0.633

0.790

0.102

19

6

0.789

0.745

0.761

23

6

0.652

0.705

0.352


FaA12

(FJ375936)



F: TCCTCCGAGTCTTCCTACC

R: AAGCCAGATTCAAGCATTG



(AC)11

177–179

30

2

0.200

0.183

1.000

19

2

0.053

0.053



23

1

0.000

0.000



FaB102

(FJ375937)



F: TAAAGCTGTTTGCACAATCTC

R: ACCATTTTATCTGTTGATCCAG



(CT)16

207–211

30

2

0.167

0.155

1.000

19

2

0.158

0.149

1.000

23

2

0.217

0.198

1.000

FaB101
(FJ375938)

F: TGGTGGAAAAGGTTTGTTG
R: GCATCAAGGATTGTTGTCTC

(TC)6(CCTC)3

(TC)20



185–265

30

6

0.800

0.696

0.946

19

6

0.789

0.710

0.803

23

4

0.652

0.631

0.694

FaA110

(FJ375939)



F: CAAAGTTAGCCAAAGTCAACTG

R: CCAACATCAAACCTACTTGAAC



(GT)18

296–320

30

3

0.533

0.603

0.160

19

4

0.526

0.514

0.619

23

4

0.348

0.345

0.624

FaB7

(FJ375940)



F: ATGGAAGGGAGAAGACAGTC

R: ATCTGAAACCAACAGGACAAC



(TC)14

142–150

30

5

0.633

0.651

0.556

19

4

0.632

0.613

0.660

23

4

0.652

0.617

0.750

FaA104

(FJ375941)



F: GGAGGAAGACACAGTTCTGG

R: CTGGAAAGCAATACCAAGTTG



(TG)14

187–197

30

5

0.533

0.518

0.522

19

3

0.211

0.280

0.247

21

4

0.381

0.336

1.000

FaB106

(FJ375942)



F: GCACTTGATTGTTTCAGCAC

R: AGAGGTGGGTTCCAATTATG



(TC)24

226–236

30

5

0.600

0.654

0.390

19

4

0.526

0.559

0.423

23

4

0.304

0.277

1.000

FaB4

(FJ375943)



F: TGCAATCACTTCTTTTGAGTTC

R: ACCAGCATTTGCCACATT



(TC)33

269–321

30

10

0.933

0.851

0.961

19

7

0.842

0.792

0.788

23

5

0.565

0.470

1.000

FaA125

(FJ375944)



F: GAGCCGCTCAAATTAATGATCT

R: CCTACCTAGCGCTATATGCAAAG



(TG)14(CG)3

117–138

30

4

0.467

0.581

0.183

19

4

0.684

0.627

0.676

23

3

0.609

0.478

0.969

FaA7

(FJ375945)



F: CCTTCGTCAACTAAAAACCA

R: GATGTTATAGCTGGACCTCAAC



(TG)17

173–191

30

5

0.633

0.698

0.265

19

6

0.789

0.671

0.968

23

4

0.696

0.664

0.860

FaA116

(FJ375946)



F: TGTTCCTCATGCTCTATGTAAC

R: TTGGTGCTGGTAAGTAAACTAG



(GT)13(AT)2

251–257

30

3

0.600

0.551

0.795

18

3

0.500

0.541

0.418

23

3

0.391

0.478

0.219

FaA3

(FJ375947)



F: TTCATTTTCTGTCCCCATGC

R: TGTGAAGCAAACATGAACACC



(CA)12(TA)4

302–314

30

4

0.533

0.584

0.088

19

4

0.684

0.696

0.344

23

4

0.652

0.598

0.715

FaA8
(FJ375948)

F: TGGAGAAGTTTGGTGTCTTG
R: GTGGGAAGCGAATGAAAG

(CA)6(CG)5

(CA)30(TA)7



118–225

30

5

0.233

0.301

0.119

19

5

0.316

0.333

0.475

23

6

0.304

0.477

0.014

FaB8

(FJ375949)



F: CTCAAGAAGATGGGGAGTGTC

R: ACATGGCATGAGTCACTACGT



(AG)17

257–261

30

3

0.267

0.242

1.000

19

3

0.421

0.432

0.190

23

3

0.261

0.240

1.000

FaB9

(FJ375950)



F: AGGGTCCAATGTATTTTAGTAG

R: ACTGGCAAGCACTGTAAG



(CT)22

308–328

30

3

0.233

0.213

1.000

19

4

0.684

0.596

0.587

22

5

0.273

0.290

0.460

(n), number of individuals successfully genotyped; (k), number of alleles; (HO), observed heterozygosity; (HE), expected heterozygosity; (HW) nominal P values for the test of deviations from Hardy–Weinberg equilibrium. PCR products were labelled using FAM, VIC, NED or PET (Applied Biosystems) dyes on an additional 19-bp M13 primer (5′- CACGACGTTGTAAAACGAC-3′) according to the methods of Boutin-Ganache et al. (2001). Moreover, a palindromic sequence tail (5′-GTGTCTT-3′) was added to the 5′ end of the reverse primer to improve adenylation and facilitate genotyping.


The reported markers will be used for directly estimating patterns of animal-mediated pollen and seed dispersal within and among a set of F. alnus populations in the ‘Los Alcornocales’ Natural Park. We will furthermore assess how the spatial genetic structure is affected by frequent secondary seed dispersal through water flow (Hampe 2004) as compared to animal-mediated dispersal. Finally, micro- satellite data will be used to guide the selection of source populations for ex-situ conservation measures.

Acknowledgements
We kindly thank the staff of the ‘Los Alcornocales’ Natural Park for permissions and logistical support in the area. A. Valido helped with sampling, and K. Holbrook and J. Muñoz made helpful com- ments on the manuscript. The study was supported by the Spanish MEC (CGL2006-00373) and Junta de Andalucía (P07-RNM02824).

References
Boutin-Ganache I, Raposo M, Raymond M, Deschepper CF (2001) M13-tailed primers improve the readability and usability of microsatellite analyses performed with two different allele-sizing methods. BioTechniques, 31, 24–27.

Godoy JA, Jordano P (2001) Seed dispersal by animals: exact

identification of source trees with endocarp DNA microsatellites.

Molecular Ecology, 10, 2275–2283.

Hampe A (2004) Extensive hydrochory uncouples spatiotemporal patterns of seedfall and seedling recruitment in a ‘bird-dispersed’ riparian tree. Journal of Ecology, 92, 797–807.

Hampe A, Arroyo J, Jordano P, Petit RJ (2003) Rangewide phylogeography of a bird-dispersed Eurasian shrub: contrasting mediterranean and temperate glacial refugia. Molecular Ecology,

12, 3415–3426.

Jones KC, Levine KF, Banks JD (2002) Characterization of 11 poly- morphic tetranucleotide microsatellites for forensic applications in California elk (Cervus elaphus canadensis). Molecular Ecology Notes, 2,

425–427.

Kalinowski ST, Taper ML, Marshall TC (2007) Revising how the com- puter program Cervus accommodates genotyping error increases success in paternity assignment. Molecular Ecology, 16, 1099–1006.

Milligan BG (1998) Total DNA isolation. In: Molecular Genetic Analysis of Populations: A Practical Approach, 2nd edn (ed. Hoelzel AR), pp.

43–44. Oxford University Press, Oxford, UK.

van Oosterhout CV, Hutchinson WF, Wills DPM, Shipley P (2004) Micro-Checker: software for identifying and correcting genotyping errors in microsatellite data. Molecular Ecology Notes, 4, 535–538.

Rousset F (2007) GenePop’007: a complete re-implementation of the GenePop. Molecular Ecology Resources, 8, 103–106.







База данных защищена авторским правом ©shkola.of.by 2016
звярнуцца да адміністрацыі

    Галоўная старонка